Neotrygon kuhlii | University of the Philippines Mindanao | Marine Biodiversity Database Project
Neotrygon kuhlii
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Elasmobranchii
  • Order » Rajiformes
  • Family » Dasyatidae
  • Genus » Neotrygon
  • Species » kuhlii
  • Neotrygon kuhlii
    (Blue-spotted stingray)
  • Description »   (Wikipedia) Kuhl's maskray (Neotrygon kuhlii), also known as the blue-spotted stingray, blue-spotted maskray, or Kuhl's stingray, is a species of stingray of the family Dasyatidae. It was recently changed from Dasyatis kuhlii in 2008 after morphological and molecular analyses showed that it is part of a distinct genus, Neotrygon. The body is rhomboidal and colored green with blue spots. Maximum disk width is estimated 46.5 cm (18.3 in). It is popular in aquaria, but usually not distinguished from the blue-spotted ribbontail ray. The ribbontail has a rounded body, is a brighter green with brighter blue and more vivid spots, but Kuhl's maskray is larger. The stingray's lifespan is estimated at 13 years for females and 10 years for males. The blue-spotted stingray preys on many fish and small mollusks. It is also generally found from Indonesia to Japan, and most of Australia. Kuhl's maskray also is targeted by many parasites, such as tapeworms, flatworms, and flukes.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_STAC_2211_037A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524529
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 8:48 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTACTTAGTCTTTGGTGCATGAGCAGGGATAGTAGGCACTGGCCTCAGTTTACTTATCCGAACAGAACTAAGCCAACCAGGCGCTTTACTGGGTGATGATCAAATTTATAATGTAATCGTCACTGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTATAATCGGTGGGTTTGGTAACTGACTAGTGCCCCTGATAATTGGGGCTCCGGACATAGCCTTTCCACGAATAAATAACATAAGTTTTTGACTTCTACCTCCCTCATTCTTATTACTGCTAGCCTCAGCAGGAGTAGAGGCCGGAGCTGGAACAGGTTGAACAGTTTATCCCCCATTAGCTGGTAACATAGCACATGCCGGAGCTTCTGTAGACCTTACAATCTTCTCTCTTCACCTAGCAGGTGTTTCCTCTATTCTGGCATCCATTAACTTTATCACAACAATTATTAATATAAAACCACCTGCAATCTCCCAATATCAAACCCCATTATTCGTCTGATCTATTCTTGTTACAACTGTACTTCTCCTGCTATCCCTACCAGTCCTAGCAGCTGGCATTACTATACTCCTCACAGACCGAAATCTTAATACAACTTTCTTCGACCCAGCTGGGGGAGGAGATCCCATTCTCTACCAACACCTCTCCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 387 visit(s) today - 305318 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)