Cantherhines pardalis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Cantherhines pardalis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Tetraodontiformes
  • Family » Monacanthidae
  • Genus » Cantherhines
  • Species » pardalis
  • Cantherhines pardalis
    (Honeycomb filefish)
  • Description »   (Wikipedia) Cantherhines pardalis is a species of fish in the family Monacanthidae, the filefishes. Common names include honeycomb filefish, honeycomb leatherjacket, and wire-netting filefish. It is native to the Indian Ocean, the eastern Atlantic, and the western Pacific, except for the seas around Hawaii, where it is replaced by Cantherhines sandwichiensis.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2111_012A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524277
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 9:34 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTACTTAATTTTTGGTGCTTGAGCCGGAATAGCAGGGACTGCTCTAAGCCTTTTAATTCGGGCGGAGCTAAGCCAGCCCGGCGCCCTTCTGGGGGACGACCAAATTTATAATGTGATCGTCACAGCTCACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAGTCATGATTGGAGGCTTCGGAAACTGGCTTATTCCACTGATAATTGGCGCCCCCGACATGGCCTTTCCTCGAATGAACAATATGAGCTTCTGACTGCTCCCCCCTTCTCTTCTTCTCCTCCTCGCTTCTTCAGGAGTTGAGGCTGGAGCCGGAACTGGTTGGACCGTATACCCCCCTCTAGCAGGCAACCTTGCCCATGCAGGAGCATCCGTAGATTTAACAATTTTCTCTCTGCATCTAGCGGGTATCTCCTCAATCCTTGGTGCAATTAATTTCATTACAACCATCATTAATATGAAACCTCCGACTATTTCCCAATATCAAACCCCTTTATTCGTATGAGCTGTCCTAATTACAGCCGTACTTCTTCTTCTCTCATTACCTGTACTTGCTGCTGGTATTACAATACTTTTAACTGACCGAAATTTAAATACCACCTTCTTCGACCCAGCCGGAGGGGGAGACCCAATTTTATATCAACATTTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 546 visit(s) today - 304032 total visits (552 average daily visits): 2023-05-22 - 2024-11-23 (551 days)