Halichoeres chloropterus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Halichoeres chloropterus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Halichoeres
  • Species » chloropterus
  • Halichoeres chloropterus
    (Pastel-green wrasse)
  • Description »   (Wikipedia) The pastel-green wrasse (Halichoeres chloropterus), also known as the black-blotched rainbowfish, black=blotched wrasse, dark-blotch wrasse or green-spotted wrasse, is a species of wrasse native to the central western Pacific Ocean. It can be found on coral reefs and the surrounding areas at depths from the surface to 10 m (33 ft). Its coloration varies depending upon the habitat in which it occurs, ranging from bright green in fish living in areas with heavy algal growth to pale or with dark bars for those inhabiting rubble areas. This species can reach 19 cm (7.5 in) in standard length. It is of minor importance to local commercial fisheries and can be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur] [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2111_004A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524409
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 18, 2024, 12:42 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTCGGAGCCTGAGCCGGGATGGTAGGCACAGCCCTAAGCTTGCTCATCCGAGCTGAGCTGGCCCAGCCCGGCGCCCTCCTTGGAGACGACCAAATTTACAATGTAATCGTCACAGCCCACGCTTTCGTAATAATTTTCTTTATAGTTATACCTATTATGATTGGTGGCTTCGGGAACTGACTTATCCCCCTAATGATTGGGGCACCAGATATGGCCTTTCCTCGAATAAACAACATGAGCTTCTGGCTCCTACCCCCCTCTTTCCTCCTCCTCCTCGCCTCCTCAGGCGTAGAAGCAGGCGCAGGAACCGGTTGAACGGTTTACCCGCCCCTGGCAGGCAACCTGGCCCACGCCGGAGCTTCCGTCGACCTAACCATTTTCTCACTTCACTTAGCTGGTATCTCATCCATTCTAGGGGCAATTAACTTTATTACAACTATTATTAATATGAAGCCCCCAGCAATCTCCCAGTACCAAACACCCCTCTTCGTGTGGGCCGTTCTAATTACAGCAGTTCTGCTCCTCCTTTCTCTTCCTGTACTAGCCGCCGGCATCACCATGCTCCTAACAGACCGTAACCTTAATACCACCTTCTTCGACCCCGCAGGAGGAGGTGATCCCATCCTCTACCAACACCTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 170 visit(s) today - 305101 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)