Pristipomoides typus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Pristipomoides typus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Lutjanidae
  • Genus » Pristipomoides
  • Species » typus
  • Pristipomoides typus
    (Sharptooth jobfish)
  • Description »   (Wikipedia) Pristipomoides typus, also known as the sharptooth jobfish, white snapper, white jobfish, goldband snapper or threadfin snapper, is a species of ray-finned fish, a snapper belonging to the family Lutjanidae. It is found in the Indian and Pacific Oceans.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_TORL_2206_010A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524597
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 8:38 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCCTCAGCTTGCTTATTCGGGCAGAACTGAGCCAACCGGGCGCACTTCTTGGAGACGACCAGATTTATAACGTAATCGTTACAGCCCACGCATTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGCGGCTTTGGGAATTGACTGATTCCCCTGATGATTGGAGCCCCTGATATGGCATTCCCCCGAATAAACAATATGAGCTTTTGACTTCTACCCCCTTCTTTCCTCCTTCTCCTCGCTTCTTCAGGAGTAGAGGCCGGAGCTGGTACGGGATGAACAGTATACCCCCCTTTAGCTGGAAACTTAGCGCATGCGGGAGCATCCGTTGATCTTACCATCTTTTCTCTTCATTTAGCAGGTGTTTCTTCCATCCTGGGAGCAATTAATTTTATTACAACCATTATTAATATGAAACCTCCTGCTATTTCCCAATACCAAACACCCCTATTTGTGTGAGCTGTTCTAATTACCGCCGTCCTACTTCTCCTATCACTTCCTGTCCTTGCTGCCGGAATTACAATACTCCTAACAGACCGAAATTTAAATACTACTTTCTTTGATCCAGCAGGAGGAGGTGACCCAATCCTCTACCAACACCTCTCTTGATTCTTT

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1193 visit(s) today - 304679 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)