Pristipomoides typus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Pristipomoides typus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Lutjanidae
  • Genus » Pristipomoides
  • Species » typus
  • Pristipomoides typus
    (Sharptooth jobfish)
  • Description »  

    Marine; demersal; depth range 40 - 120 m . Tropical; 32°N - 12°S, 93°E - 157°E

    Maturity: Lm ?, range 28 - ? cm Max length : 70.0 cm TL male/unsexed; ; max. published weight: 4.2 kg ; max. reported age: 11 years

    Dorsal spines (total): 10; Dorsal soft rays (total): 11 - 12; Anal spines: 3; Anal soft rays: 8. Interorbital space flat. Bases of dorsal and anal fins without scales, their last soft rays extended into short filaments. Pectoral fins long, reaching level of anus. Scale rows on back parallel to lateral line. Overall color rosy red; the top of the head with longitudinal vermiculated lines and spots of brownish yellow; the dorsal fin with wavy yellow lines. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_TORL_2206_010A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:05 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524597
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:25 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCCTCAGCTTGCTTATTCGGGCAGAACTGAGCCAACCGGGCGCACTTCTTGGAGACGACCAGATTTATAACGTAATCGTTACAGCCCACGCATTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGCGGCTTTGGGAATTGACTGATTCCCCTGATGATTGGAGCCCCTGATATGGCATTCCCCCGAATAAACAATATGAGCTTTTGACTTCTACCCCCTTCTTTCCTCCTTCTCCTCGCTTCTTCAGGAGTAGAGGCCGGAGCTGGTACGGGATGAACAGTATACCCCCCTTTAGCTGGAAACTTAGCGCATGCGGGAGCATCCGTTGATCTTACCATCTTTTCTCTTCATTTAGCAGGTGTTTCTTCCATCCTGGGAGCAATTAATTTTATTACAACCATTATTAATATGAAACCTCCTGCTATTTCCCAATACCAAACACCCCTATTTGTGTGAGCTGTTCTAATTACCGCCGTCCTACTTCTCCTATCACTTCCTGTCCTTGCTGCCGGAATTACAATACTCCTAACAGACCGAAATTTAAATACTACTTTCTTTGATCCAGCAGGAGGAGGTGACCCAATCCTCTACCAACACCTCTCTTGATTCTTT