Scarus dimidiatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scarus dimidiatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Scarus
  • Species » dimidiatus
  • Scarus dimidiatus
    (Yellowbarred parrotfish)
  • Description »  

    Marine; brackish; reef-associated; depth range 1 - 25 m . Tropical; 30°N - 24°S, 107°E - 170°W

    Maturity: Lm ?  range ? - ? cm Max length : 40.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9. Males recognized by the blue snout and band behind eye. Eastern form has blue cheek and western form has yellow cheek. Females grey to yellow with dusky saddle over back . Closely resembles S. oviceps and S. scaber. In S. oviceps, the initial phase has fewer, less vertical diagonal dark bars on the back and the terminal phase lacks the light-centered bar between the eye and the pectoral fin base, is darker and less brilliant blue on the upper head and back, and is usually larger. Body shape (shape guide): elongated;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur] [Sasa, Davao City, Davao Del Sur] [Sasa, Davao City, Davao del Sur] [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2110_003A] [FDP_IGCS_2111_022A] [FDP_IGCS_2111_022B] [FDP_IGCS_2202_012A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:17 September 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524637
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:48 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTTTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTTCTCATCCGAGCTGAATTAAGTCAACCCGGGGCCCTTCTCGGAGACGACCAGATTTATAATGTTATCGTTACAGCTCATGCATTTGTAATGATCTTTTTTATAGTCATGCCTATCATGATTGGAGGCTTTGGAAACTGACTCATCCCACTTATGATTGGGGCACCCGACATGGCCTTCCCTCGGATAAACAACATGAGCTTCTGACTTCTCCCTCCTTCCTTTCTCCTACTGCTTGCCTCCTCTGGCGTAGAAGCAGGGGCAGGTACCGGATGAACCGTCTACCCCCCTCTAGCTGGAAATCTTGCACACGCAGGTGCATCCGTCGACCTGACAATTTTCTCCCTTCATCTGGCAGGAATTTCTTCTATCCTAGGGGCAATTAACTTTATCACAACCATCATTAACATAAAACCACCTGCCATCTCCCAATACCAAACCCCCCTGTTCGTATGAGCTGTTTTAATTACTGCCGTCCTTCTTCTCCTCTCACTTCCTGTCCTTGCTGCAGGAATCACAATGCTCCTCACAGATCGGAATCTAAACACTACCTTCTTTGACCCTGCAGGCGGAGGAGACCCAATTCTTTATCAACACCTATTCTGATTCTTC