Aurigequula fasciata | University of the Philippines Mindanao | Marine Biodiversity Database Project
Aurigequula fasciata
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Leiognathidae
  • Genus » Aurigequula
  • Species » fasciata
  • Aurigequula fasciata
    (Striped ponyfish)
  • Description »   (Wikipedia) The striped ponyfish (Aurigequula fasciata) is a species of marine ray-finned fish, a ponyfish from the family Leiognathidae. It is native to the Indian Ocean and the western Pacific Ocean, from the Red Sea and the eastern coast of Africa to Fiji and Samoa, where it occurs in coastal marine and brackish waters. It occurs at depths of from 20 to 50 metres (66 to 164 ft). It is a predator upon smaller fishes, small crustaceans and polychaete worms. This species grows to a length of 21 centimetres (8.3 in) TL though most do not exceed 17 centimetres (6.7 in) TL. It is of minor importance to local commercial fisheries. This species is the only known member of its genus.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2209_006A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524256
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 8:18 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATATAGTATTTGGTGCTTGAGCTGGAATGGTAGGAACAGCCCTAAGTCTTCTTATCCGAGCAGAATTAAGCCAGCCTGGAGCTCTTCTTGGAGATGACCACATTTACAATGTTATTGTTACCGCACACGCATTCGTAATAATTTTTTTTATGGTCATACCCATTATAATTGGAGGCTTTGGTAACTGACTCATCCCCCTAATAATTGGAGCCCCCGACATGGCATTCCCACGCATAAACAACATAAGCTTCTGACTTCTTCCCCCATCATTCTTACTCCTCCTAGCATCTTCAGGCATCGAAGCTGGCGCAGGCACCGGCTGAACAGTATACCCCCCTCTCGCCGGCAACCTTGCCCACGCAGGCGCTTCCGTAGACCTGACCATCTTCTCACTTCATCTCGCCGGAATCTCGTCAATCCTAGGGGCCATTAACTTCATTACAACAATTATTAACATAAAACCCCCAGCCATCTCACAATTTCAAACCCCTCTATTCGTCTGAGCAGTGCTCATTACAGCAGTCCTTCTTCTCCTCTCCCTCCCAGTTCTCGCAGCGGGTATCACAATACTGCTTACTGACCGCAACCTCAACACCACATTCTTTGATCCTGCAGGAGGAGGAGATCCAATCCTGTACCAGCACTTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1271 visit(s) today - 303368 total visits (552 average daily visits): 2023-05-22 - 2024-11-22 (550 days)