Iniistius bimaculatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Iniistius bimaculatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Iniistius
  • Species » bimaculatus
  • Iniistius bimaculatus
    (Two-spot razorfish)
  • Description »   (Wikipedia) Iniistius bimaculatus, the two-spot razorfish, is a species of marine ray-finned fish from the family Labridae, the wrasses. It is found in the Indo-West Pacific, the Red Sea, the Persian Gulf, and off the coasts of India.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2209_002A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524433
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 9:52 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTGTATTTAATCTTCGGTGCTTGGGCCGGGATAGTAGGCACAGCCCTGAGTTTACTTATTCGGGCAGAACTAAGCCAGCCTGGCGCTCTCCTTGGAGACGATCAAATTTACAATGTGATCGTCACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGCGGATTTGGAAACTGACTCATCCCCCTAATAATCGGCGCCCCAGACATGGCCTTCCCTCGAATGAATAATATGAGTTTTTGACTTCTCCCCCCCTCTTTCCTGCTTCTCTTAGCCTCGTCGGGAGTGGAAGCTGGTGCCGGAACGGGCTGAACTGTATACCCCCCACTAGCGGGAAACCTCGCCCACGCAGGTGCATCCGTTGACTTAACAATTTTCTCCCTCCACTTGGCAGGAATCTCCTCAATCCTAGGGGCGATCAATTTTATTACCACAATTATTAATATGAAGCCCCCAGCCATTTCCCAGTACCAAACTCCCCTATTTGTCTGGGCTGTTCTTATCACTGCTGTTCTTCTTCTTCTCTCGCTCCCTGTCCTTGCCGCAGGCATTACAATGCTTCTGACAGATCGAAATCTGAACACAACCTTCTTTGACCCCGCCGGGGGAGGGGATCCTATCCTCTACCAGCACTTATTCTGA