Scarus flavipectoralis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scarus flavipectoralis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Scarus
  • Species » flavipectoralis
  • Scarus flavipectoralis
    (Yellowfin parrotfish)
  • Description »  

    Marine; reef-associated; depth range 2 - 40 m , usually 20 - ? m . Tropical; 19°N - 24°S

    Maturity: Lm ?  range ? - ? cm Max length : 40.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9. Males recognized by the yellow pectoral fins, horizontal green band from tip of snout to above pectoral fin base and large individuals with oval yellow patch on caudal peduncle. Females plain yellowish grey with pale lines along abdominal area . Scales large. Median predorsal scales 4; 3 scale rows on cheek, ventral row with 1-2 scales. Truncate caudal fin in initial phase (slightly rounded); slightly lunate in terminal phase. Dental plates nearly covered by lips. Terminal males with 1 or 2 upward-projecting canines posteriorly on lower dental plate and 1 on upper plate. Large initial phase individuals are tan while terminal phase individuals have a distinctive transparent yellowish-tan pectoral fin . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2208_048A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:17 September 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524638
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:18 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTTCTCATCCGAGCTGAATTAAGCCAACCCGGGGCCCTTCTCGGGGACGATCAAATTTACAATGTCATCGTCACAGCTCATGCATTTGTAATAATCTTTTTTATAGTCATACCCATCATGATCGGAGGCTTCGGTAATTGACTCATCCCACTTATGATCGGGGCACCCGACATGGCCTTTCCCCGAATGAACAACATGAGCTTCTGACTTCTCCCACCCTCCTTCCTACTATTGCTTGCCTCCTCTGGCGTAGAAGCAGGAGCAGGAACCGGATGAACCGTTTACCCGCCCCTAGCGGGAAATCTCGCACACGCAGGTGCATCCGTTGATCTAACAATCTTCTCCCTTCACCTGGCAGGAATTTCTTCAATCCTGGGAGCAATCAACTTCATTACAACCATTATTAACATGAAACCGCCTGCCATCTCTCAGTACCAAACCCCCCTCTTCGTATGGGCCGTTTTAATCACTGCCGTGCTTCTTCTCCTCTCCCTTCCTGTTCTTGCTGCCGGAATTACAATACTACTGACAGATCGAAACCTAAACACTACTTTCTTTGATCCTGCAGGCGGAGGAGACCCAATTCTCTATCAACACTTATTCTGA