Scarus flavipectoralis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scarus flavipectoralis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Scarus
  • Species » flavipectoralis
  • Scarus flavipectoralis
    (Yellowfin parrotfish)
  • Description »   (Wikipedia) Scarus flavipectoralis, the yellow-fin parrotfish, also known as the king parrotfish, is a species of marine ray-finned fish, a parrotfish in the family Scaridae. It is found in the western Central Pacific from the Philippines east to the Solomon Islands, north to the Marshall Islands and south to Scott Reef and the Great Barrier Reef, it has also been recorded from Tonga.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2208_048A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524638
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 8:09 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTTCTCATCCGAGCTGAATTAAGCCAACCCGGGGCCCTTCTCGGGGACGATCAAATTTACAATGTCATCGTCACAGCTCATGCATTTGTAATAATCTTTTTTATAGTCATACCCATCATGATCGGAGGCTTCGGTAATTGACTCATCCCACTTATGATCGGGGCACCCGACATGGCCTTTCCCCGAATGAACAACATGAGCTTCTGACTTCTCCCACCCTCCTTCCTACTATTGCTTGCCTCCTCTGGCGTAGAAGCAGGAGCAGGAACCGGATGAACCGTTTACCCGCCCCTAGCGGGAAATCTCGCACACGCAGGTGCATCCGTTGATCTAACAATCTTCTCCCTTCACCTGGCAGGAATTTCTTCAATCCTGGGAGCAATCAACTTCATTACAACCATTATTAACATGAAACCGCCTGCCATCTCTCAGTACCAAACCCCCCTCTTCGTATGGGCCGTTTTAATCACTGCCGTGCTTCTTCTCCTCTCCCTTCCTGTTCTTGCTGCCGGAATTACAATACTACTGACAGATCGAAACCTAAACACTACTTTCTTTGATCCTGCAGGCGGAGGAGACCCAATTCTCTATCAACACTTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 779 visit(s) today - 304265 total visits (552 average daily visits): 2023-05-22 - 2024-11-23 (551 days)