Lobotes surinamensis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lobotes surinamensis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Lobotidae
  • Genus » Lobotes
  • Species » surinamensis
  • Lobotes surinamensis
    (Tripletail)
  • Description »   (Wikipedia) The Atlantic tripletail (Lobotes surinamensis), also known as the black grunt, black perch, buoy fish, buoyfish, brown triple tail, brown tripletail, conchy leaf, dusky triple-tail, dusky tripletail, flasher, sleepfish, triple tail, triple-tail, tripletail, or tripple tail is a species of marine ray-finned fish belonging to the family Lobotidae. This fish is found in tropical and subtropical waters around the world except for the eastern Pacific Ocean.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2208_040A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524459
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 8:01 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATTTAGTGTTTGGTGCTTGAGCTGGAATGGTTGGTACAGCCCTTAGTCTTCTTATTCGAGCCGAGCTAAATCAGCCAGGGGCTCTACTAGGAGACGACCAGACCTATAATGTCATTGTGACAGCCCATGCATTTGTCATAATCTTCTTTATAGTAATACCAATTATAATTGGCGGATTCGGCAACTGACTAATCCCACTAATAATTGGTGCTCCTGATATAGCATTCCCTCGAATAAACAACATGAGCTTCTGACTTCTTCCCCCCTCGTTCCTCCTTCTCCTCGCCTCCTCGGGCGTAGAAGCTGGGGCCGGGACAGGTTGAACAGTTTACCCCCCACTGGCAAGTAACTTGGCTCACGCTGGGGCATCAGTTGACCTCACTATCTTTTCCTTACACTTAGCAGGTATTTCTTCAATCCTTGGGGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCTGCCGTCTCTCAGTACCAAACCCCTCTGTTTGTATGGGCAGTTCTTATTACTGCGGTCCTTCTCCTTTTATCCCTCCCAGTCCTTGCCGCAGGCATCACTATGCTTCTGACAGATCGTAACTTAAATACTACATTCTTTGACCCAGCCGGTGGAGGGGACCCCATCCTCTATCAACACCTTTTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 548 visit(s) today - 305479 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)