Lutjanus timoriensis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lutjanus timoriensis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Lutjanidae
  • Genus » Lutjanus
  • Species » timoriensis
  • Lutjanus timoriensis
    (Timor snapper)
  • Description »  

    Marine; reef-associated; depth range 20 - 150 m . Tropical; 21°N - 20°S, 92°E - 177°W

    Maturity: Lm ?  range ? - ? cm Max length : 73.7 cm FL male/unsexed; ; common length : 30.0 cm TL male/unsexed; ; max. published weight: 6.7 kg

    Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 15; Anal spines: 3; Anal soft rays: 8. Dorsal profile of head steeply sloped. Preorbital width greater than eye diameter. Preopercular notch and knob poorly developed. Scale rows on back rising obliquely above lateral line. Axil of pectoral fin black. Young with a blackish or brownish band from upper jaw to the beginning of dorsal fin and a black saddle preceded by a pearly-white border on upper edge of caudal peduncle; horizontal stripes on sides . Body depth 2.2-2.4 in SL . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2208_035A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:05 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524480
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 12:59 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACTGCCCTAAGCCTGCTCATTCGAGCAGAACTTAGTCAACCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATCGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTGATACCAATCATGATCGGGGGGTTCGGAAACTGACTTATCCCACTTATGATCGGAGCCCCCGACATGGCATTCCCTCGAATAAATAATATGAGCTTTTGACTTCTGCCCCCTTCTTTCCTTCTCCTTCTTGCATCTTCTGGGGTAGAGGCCGGAGCCGGGACCGGGTGAACAGTTTATCCTCCTCTGGCGGGGAACCTCGCACACGCGGGGGCATCTGTTGACTTAACCATCTTTTCTCTCCACCTAGCGGGGGTCTCTTCAATCCTAGGCGCTATCAACTTTATCACCACAATCATTAACATAAAACCACCGGCTATTTCCCAATACCAAACACCTCTCTTTGTTTGAGCTGTCCTAATTACCGCCGTCCTTCTCCTTCTTTCCCTCCCAGTCCTAGCTGCCGGAATTACAATACTTCTCACGGACCGAAACTTAAATACCACCTTCTTTGATCCTGCAGGAGGAGGGGACCCAATTCTTTACCAGCACCTCT