Atule mate | University of the Philippines Mindanao | Marine Biodiversity Database Project
Atule mate
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Carangiformes
  • Family » Carangidae
  • Genus » Atule
  • Species » mate
  • Atule mate
    (Yellowtail scad)
  • Description »  

    Marine; brackish; reef-associated; depth range 1 - 80 m . Tropical; 35°N - 35°S, 24°E - 135°W

    Maturity: Lm ?, range 17 - ? cm Max length : 30.0 cm TL male/unsexed; ; common length : 26.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 22 - 25; Anal spines: 3; Anal soft rays: 18 - 21. This species is distinguished by the following characters: adipose eyelid well developed and completely covering eye except for a vertical slit centred on pupil; shoulder girdle (cleithrum) margin smooth, without papillae; terminal dorsal and anal rays finlet-like in adults, about twice length of adjacent rays and a little more separated but joined by interradial membrane; lateral line gently arched anteriorly, with junction of curved and straight parts below vertical from sixth to eighth soft rays of second dorsal fin; scales in curved part of lateral line 39 to 57; straight part with 0 to 10 scales and 36 to 49 scutes; a black spot, slightly smaller than eye, on upper margin of opercle and adjacent area of shoulder; dorsal and caudal fins dusky greenish yellow; anal fin pale yellow .
    Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2208_003A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:06 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524255
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:22 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCTTTAAGCTTACTTATCCGAGCAGAACTTAGTCAACCTGGCGCCCTTTTGGGGGATGACCAAATTTATAACGTAATTGTTACGGCCCACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTCGGAAACTGACTTATCCCCCTAATGATCGGAGCCCCAGACATGGCATTCCCTCGAATAAATAATATGAGCTTCTGACTTCTTCCCCCTTCTTTCTTATTACTTTTGGCTTCTTCAGGAGTCGAAGCCGGGGCCGGGACTGGTTGAACTGTTTACCCGCCCCTAGCCGGCAACCTTGCCCACGCCGGAGCATCCGTAGATTTAACCATTTTCTCCCTTCACCTAGCAGGGGTCTCCTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCTCCCGCAGTATCAATGTACCAAATTCCACTATTTGTTTGAGCTGTCTTAATTACAGCTGTTCTTCTTCTTTTATCTCTCCCAGTTTTAGCCGCTGGAATTACAATGCTCTTAACAGATCGAAACCTAAATACTGCTTTCTTTGACCCAGCAGGAGGGGGAGATCCAATTCTTTACCAACATTTATTCTGA