Atule mate | University of the Philippines Mindanao | Marine Biodiversity Database Project
Atule mate
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Carangiformes
  • Family » Carangidae
  • Genus » Atule
  • Species » mate
  • Atule mate
    (Yellowtail scad)
  • Description »   (Wikipedia) The yellowtail scad (Atule mate) (also known as the northern yellowtail scad, one-finlet scad, deep trevally and omaka), is an abundant species of small inshore marine fish of the jack family, Carangidae. The species is widespread in the Indo-Pacific region from east Africa in the west to Hawaii in the east, extending north to Japan and south to Australia. The yellowtail scad is the only member of the monotypic genus Atule and is distinguished from similar species by a well-developed adipose eyelid and finlet-like extensions of the last rays of the dorsal and anal fins. It inhabits coastal areas such as bays and coral reefs, preying on small fishes and crustaceans. Spawning has been well studied in Hawaii, where fish enter bays to spawn, releasing up to 161,000 eggs each between March and October. The yellowtail scad is an important component of fisheries throughout its range, taken by a number of netting and hook-and-line methods. It is a prized food fish in some regions and is cooked or preserved by a variety of methods.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2208_003A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524255
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 7:16 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCTTTAAGCTTACTTATCCGAGCAGAACTTAGTCAACCTGGCGCCCTTTTGGGGGATGACCAAATTTATAACGTAATTGTTACGGCCCACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTCGGAAACTGACTTATCCCCCTAATGATCGGAGCCCCAGACATGGCATTCCCTCGAATAAATAATATGAGCTTCTGACTTCTTCCCCCTTCTTTCTTATTACTTTTGGCTTCTTCAGGAGTCGAAGCCGGGGCCGGGACTGGTTGAACTGTTTACCCGCCCCTAGCCGGCAACCTTGCCCACGCCGGAGCATCCGTAGATTTAACCATTTTCTCCCTTCACCTAGCAGGGGTCTCCTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCTCCCGCAGTATCAATGTACCAAATTCCACTATTTGTTTGAGCTGTCTTAATTACAGCTGTTCTTCTTCTTTTATCTCTCCCAGTTTTAGCCGCTGGAATTACAATGCTCTTAACAGATCGAAACCTAAATACTGCTTTCTTTGACCCAGCAGGAGGGGGAGATCCAATTCTTTACCAACATTTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1304 visit(s) today - 303401 total visits (552 average daily visits): 2023-05-22 - 2024-11-22 (550 days)