Cheilinus chlorourus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Cheilinus chlorourus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Cheilinus
  • Species » chlorourus
  • Cheilinus chlorourus
    (Floral wrasse)
  • Description »   (Wikipedia) The floral wrasse (Cheilinus chlorourus) is a species of wrasse native to the Indian Ocean and the western Pacific Ocean from the coast of Africa to the Tuamotus and Marquesas. Its range extends as far north as the Ryukyus and south to New Caledonia. It is an inhabitant of reefs in lagoons or coastal waters at depths of from 1 to 30 m (3.3 to 98.4 ft). This species can reach 45 cm (18 in) in total length. It is of minor importance to local commercial fisheries and can also be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2207_064A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524325
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 7:05 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTCTATCTAGTATTTGGTGCCTGAGCTGGGATAGTAGGTACTGCCCTTAGCCTACTCATCCGAGCGGAACTTAGCCAACCAGGCGCTCTTCTTGGAGACGACCAGATCTATAATGTAATCGTAACAGCCCATGCTTTCGTTATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGGCTAATCCCCCTTATGATCGGCGCTCCCGACATGGCCTTTCCTCGTATGAACAATATGAGCTTTTGGCTCCTTCCTCCCTCTTTCCTCCTTCTTCTTGCATCCTCTGGCGTAGAAGCAGGGGCTGGTACGGGTTGAACAGTTTACCCCCCACTAGCCGGAAATTTGGCCCACGCAGGTGCATCCGTAGATTTAACAATCTTCTCTCTTCACCTAGCCGGGATCTCCTCAATTTTAGGAGCCATTAATTTCATCACCACTATTATTAACATGAAACCCCCAGCCATCACTCAGTACCAAACCCCCCTATTCGTCTGAGCAGTCCTCATTACAGCCGTTCTTCTACTACTTTCACTCCCCGTCCTCGCTGCGGGCATTACAATGCTTCTCACGGACCGAAACCTAAACACAACCTTCTTCGACCCGGCAGGAGGGGGAGACCCAATTCTCTACCAACACCTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1011 visit(s) today - 304497 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)