Lutjanus rufolineatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lutjanus rufolineatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Lutjanidae
  • Genus » Lutjanus
  • Species » rufolineatus
  • Lutjanus rufolineatus
    (Yellow-lined snapper)
  • Description »  

    Marine; reef-associated; depth range 8 - 50 m . Tropical; 25°N - 35°S, 115°E - 170°W

    Maturity: Lm ?  range ? - ? cm Max length : 30.0 cm TL male/unsexed;

    Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 14; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body moderately deep; greatest depth 2.4-2.6 in SL; preopercular notch and knob well developed; vomerine tooth patch crescentic, without medial posterior extension; gill rakers of first gill arch 6-7 + 13-15 = 20-23; caudal fin emarginate; scale rows on back rising obliquely above lateral line. Colour generally grey to pinksh, silvery ventrally; a series of 10-12 faint yellow stripes on side; some specimens with a black spot, eye size or smaller, below anterior part of soft dorsal fin at level of lateral line; spinous dorsal fin whitish with a yellow margin; median fins yellowish, although pelvic fins sometimes white; axil of pectoral fins brown on dorsal portion ( Ref. 9821, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2207_059A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:05 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524478
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 12:58 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACGGCCCTAAGCCTGCTCATCCGAGCAGAACTGAGCCAACCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTCGGAAACTGACTAATCCCCCTAATGATCGGAGCCCCTGATATGGCATTTCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCTCCATCATTTCTTCTACTTCTGGCCTCCTCAGGAGTAGAGGCAGGTGCCGGGACTGGATGAACAGTCTACCCTCCCCTGGCAGGGAACCTCGCACACGCAGGAGCATCAGTTGACCTAACTATTTTCTCCCTACACCTGGCGGGTGTTTCTTCAATTCTAGGGGCCATTAACTTCATTACCACAATTATCAACATGAAACCCCCAGCCATTTCCCAATATCAAACACCGCTATTCGTCTGAGCCGTTCTAATTACCGCTGTCCTGCTCCTTCTTTCCCTTCCCGTCCTAGCTGCCGGAATTACAATGCTTCTTACAGATCGAAATTTAAACACCACCTTCTTCGACCCTGCAGGAGGAGGAGATCCCATTCTCTATCAACACCTGTTCTGATTCTTC