Scarus forsteni | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scarus forsteni
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Scarus
  • Species » forsteni
  • Scarus forsteni
    (Forsten's parrotfish)
  • Description »  

    Marine; reef-associated; depth range 3 - 30 m . Tropical; 30°N - 28°S

    Maturity: Lm ?  range ? - ? cm Max length : 55.0 cm TL male/unsexed; ; max. published weight: 2.5 kg

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9. This species is distinguished by the following characters: median predorsal scales 6-7; 3 scale rows on cheek,1(5-7), 2(6-9), 3(2-5); pectoral-fin rays 13-14 (usually 14); dental plates partially covered by lips and large adult with 1-2 conical teeth on side of upper dental plates; caudal fin emarginate in female and lunate in terminal male. Colour of male green with pink scale edges (pink colour sometimes cover much of the central body), green band around mouth with extension below eye and violet zone on upper head; female generally pale grey with broad zone of yellowish brown on middle of side, a small pale dot above diffuse blue-green patch on mid-side and a dark band from eye to pectoral region ( Ref. 9793, 90102). Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2207_049A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Not Evaluated (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524639
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 27, 2024, 5:55 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTTTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTCCTCATCCGAGCTGAATTAAGTCAACCCGGGGCCCTTCTCGGAGACGACCAGATCTATAATGTTATCGTTACAGCTCATGCATTTGTAATAATCTTTTTTATGGTCATGCCTATCATGATTGGAGGCTTCGGAAACTGACTCATCCCGCTCATGATCGGAGCACCCGACATGGCCTTCCCTCGAATGAACAATATGAGCTTCTGACTTCTCCCTCCCTCCTTTCTCCTATTGCTCGCCTCCTCTGGCGTAGAAGCAGGAGCAGGTACCGGATGAACCGTTTACCCCCCTCTAGCAGGAAATCTTGCACACGCAGGTGCATCCGTCGACCTAACAATTTTCTCTCTTCACCTGGCAGGAATTTCTTCCATCCTGGGAGCAATTAACTTTATCACAACCATCATTAACATGAAACCGCCTGCCATCTCCCAATACCAAACCCCCCTATTCGTTTGAGCAGTATTAATTACTGCCGTTCTTCTTCTCCTCTCACTTCCTGTCCTTGCTGCAGGAATCACAATGCTTCTTACAGATCGAAATCTAAACACTACTTTCTTTGACCCCGCAAGTGGAGGAGACCCAATTCTTTATCAACACCTGTTCTGATTCTTC