Choerodon anchorago | University of the Philippines Mindanao | Marine Biodiversity Database Project
Choerodon anchorago
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Choerodon
  • Species » anchorago
  • Choerodon anchorago
    (Orange-dotted tuskfish)
  • Description »  

    Marine; reef-associated; depth range 1 - 25 m . Tropical; 15°N - 30°S

    Maturity: Lm ?, range 23 - ? cm Max length : 50.0 cm TL male/unsexed;

    Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 7; Anal spines: 3; Anal soft rays: 9. This species is distinguished by the following characters: body deep, its depth 2.4-2.7 times in standard length; dorsal profile of head convexly curved above eyes; anterior tip of head forming a broad angle with snout steeply inclined; jaws prominent; 4 strong canines situated anteriorly in each jaw with second pair in lower jaw directed laterally; an enlarged canine present on each side at rear of upper jaw; D XIII,7, continuous with spines and anterior soft rays of similar length; A III,9; pectoral fins with ii unbranched and 13-14 branched rays; pelvic fins not filamentous; caudal fin truncate to slightly rounded; lateral line continuous, smoothly curved, with 29 pored scales; scales barely reaching onto bases of dorsal and anal fins; scales in front of dorsal fin distinctly not extending forward to above eye; cheek and opercle scaly, scales on preopercle small, less than 1/4 the size of those on body; lower jaw without scales. Colour of body greenish to grey with underside of head, chest and lower portion of sides white or bluish; a wedge-shaped white band extending upward onto back behind pectoral fins; a large rectangular white saddle situated dorsally on caudal peduncle extending forward below rear of dorsal fin; head speckled with orange; pectoral-fin base covered by a large blue to black spot; dorsal fin greenish grey anteriorly and yellowish posteriorly; caudal fin greenish orange; anal fin yellow with orange markings; a narrow blue margin on dorsal and anal fins. Small individuals overall greenish grey with several whitish bars . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_TORL_2206_018A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:12 June 2008 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524339
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:28 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTCGGTGCCTGAGCCGGCATGGTCGGCACAGCTCTAAGCCTACTCATCCGGGCAGAACTTAACCAACCGGGCGCCCTACTCGGAGATGATCAGATTTATAATGTTATCGTAACAGCACATGCGTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATCGGGGGCTTTGGCAACTGACTCATCCCACTAATGATTGGCGCACCTGATATGGCCTTCCCTCGAATAAACAACATGAGTTTCTGACTTCTTCCTCCCTCCTTCCTTCTACTCCTAGCCTCGTCAGGTGTAGAGGCCGGAGCAGGAACAGGGTGAACAGTCTACCCGCCCCTAGCGGGAAATCTAGCCCACGCGGGAGCATCCGTTGATTTAACCATTTTCTCCCTTCATTTAGCAGGTATCTCGTCTATCCTTGGGGCCATTAACTTTATTACAACCATCATTAATATAAAACCCCCCGCTATTTCCCAGTACCAAACCCCACTGTTTGTATGAGCCGTACTAATTACAGCGGTACTTCTTCTTCTCTCCCTCCCCGTTCTTGCGGCTGGAATCACAATGCTTCTTACCGACCGAAACCTTAACACCACCTTCTTTGACCCCGCAGGGGGCGGGGACCCCATCCTCTACCAACACCTATTCTGATTCTTC