Lethrinus harak | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lethrinus harak
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Lethrinidae
  • Genus » Lethrinus
  • Species » harak
  • Lethrinus harak
    (Thumbprint emperor)
  • Description »  

    Marine; brackish; reef-associated; non-migratory; depth range 0 - 20 m . Tropical; 32°N - 32°S, 31°E - 155°W

    Maturity: Lm 19.5  range ? - 21.1 cm Max length : 54.9 cm FL male/unsexed; ; common length : 30.0 cm TL male/unsexed; ; max. published weight: 2.9 kg ; max. reported age: 15 years

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body moderately deep, its depth 2.6-2.8 times in standard length; head length 0.9-1 times in body depth, 2.7-3.1 times in SL length, dorsal profile near eye distinctly or slightly convex; snout short and blunt, its length about 2.0-2.6 times in HL, measured without the lip the snout is 0.9-1 times in cheek height, its dorsal profile nearly straight, snout angle relative to upper jaw between 60° and 70°; interorbital space convex or almost flat; posterior nostril a narrow longitudinal slit, closer to orbit than anterior nostril; eye situated close to dorsal profile, its length 3.4-4.2 times in HL; cheek not very high, its height 2.3-3.1 times in HL; lateral teeth in jaws of adults molars or rounded; outer surface of maxilla smooth or with a longitudinal ridge; D X,9 the 4th or 5th dorsal-fin spine the longest, its length 2.5-3.1 times in body depth; A III,8 with the first soft ray usually the longest, its length almost equal to or longer or shorter than length of base of soft-rayed portion of anal fin and 1.2-1.6 times in length of entire anal-fin base; pectoral-fin rays 13; pelvic-fin membranes between rays closest to body without dense melanophores; cheek without scales; 46-47 lateral-line scales usually; usually 5 ½ (sometimes 4 ½) scale rows between lateral line and base of middle dorsal-fin spines; 14-16 scale rows in transverse series between origin of anal fin and lateral line; 13-14 rows in lower series of scales around caudal peduncle; 4-8 scales in supratemporal patch; inner surface of pectoral-fin base densely covered with scales; posterior angle of operculum fully scaly. Colour of body olive or grey above, shading to silvery white below; a large elliptical black spot, often broadly edged in yellow, on side directly below lateral line and centered at a vertical near the posterior tip of pectoral fins; sometimes light blue dots bordering lower rim of eye and around nostrils; pectoral, pelvic, dorsal, and anal fins white to pinkish; caudal fin orange or reddish; vertical fins sometimes lightly mottled or striped . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur] [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_TORL_2206_025A] [FDP_SGES_2112_022A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:09 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524444
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:29 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTTTATTTAGTGTTTGGTGCCTGAGCTGGAATAGTAGGGACAGCCCTAAGCCTACTCATTCGAGCCGAACTAAGTCAGCCCGGAGCCCTTCTGGGAGACGACCAGATTTATAATGTTATCGTCACAGCACATGCTTTCGTAATAATTTTCTTTATGGTAATGCCCATTATGATTGGAGGTTTTGGCAACTGACTTATTCCCCTAATGATTGGAGCCCCCGATATGGCATTCCCCCGAATGAACAACATGAGCTTTTGACTCCTGCCCCCTTCATTCCTCCTCCTACTTGCGTCCTCAGGCGTAGAAGCCGGGGCTGGTACCGGGTGAACAGTTTACCCCCCACTAGCGGGCAACCTAGCCCATGCCGGTGCATCTGTCGACTTAACAATCTTTTCCCTCCACCTGGCAGGGGTCTCCTCAATCTTAGGGGCCATCAACTTCATTACAACAATCATTAACATGAAGCCTCCAGCTATCTCCCAGTATCAAACTCCACTGTTTGTGTGGGCCGTTCTAATTACCGCCGTACTACTTCTCCTGTCCCTACCAGTCCTTGCCGCCGGCATCACGATGCTATTGACGGACCGAAACCTAAACACCACCTTCTTTGACCCCGCAGGGGGAGGGGACCCAATCCTCTATCAGCATCTATTCTGATTCTTC