Parupeneus pleurostigma | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus pleurostigma
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » pleurostigma
  • Parupeneus pleurostigma
    (Sidespot goatfish)
  • Description »  

    Marine; reef-associated; depth range 1 - 120 m . Tropical; 30°N - 30°S

    Maturity: Lm ?  range ? - ? cm Max length : 33.0 cm TL male/unsexed; ; common length : 20.0 cm TL male/unsexed; ; max. published weight: 906.00 g

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7; Vertebrae: 24. Diagnosis: Pectoral rays 16 (rarely 15 or 17). Gill rakers 6-8 + 21-25 (total 28-32). Body depth 3.45-3.95 in SL; head length (HL) 2.85-3.1 in SL; dorsal profile of snout straight to slightly convex, the snout length 1.7-2.05 in HL; barbel length 1.3-1.55 in HL; longest dorsal spine 1.4-1.7 in HL; last dorsal soft ray of adults longer than penultimate ray, the latter contained 1.1-1.25 in length of the former; posterior margin of caudal-fin lobes straight to slightly convex; pectoral-fin length 1.3-1.5 in HL; pelvic-fin length 1.25-1.45 in HL. Body pinkish to yellowish gray, the scale edges narrowly dark, with a black spot about 3-4 scales in width on lateral line below posterior part of first dorsal fin, followed by a large pale pink to white spot; a blue spot often present on each scale above lateral line, always present posteriorly; pale blue spots, one per scale, ventrally on body, but often not visible; short blue lines radiating from eye except ventrally; barbels pale pink to white; basal third of second dorsal fin with a broad black or blackish band or a large black spot, sometimes extending onto adjacent back, the outer part of fin with narrow blue and yellow bands; anal fin with faint pale blue and yellow bands; remaining fins varying from yellowish gray to light red . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2207_023A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524558
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 1:04 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTACCTCATCTTCGGCGCTTGGGCTGGGATGGTAGGGACCGCCTTAAGCCTGCTAATTCGTGCTGAGCTTAGCCAGCCCGGCGCTCTTTTAGGCGACGACCAGATTTATAACGTAATTGTAACAGCCCACGCCTTTGTAATGATCTTCTTTATAGTAATGCCAATCATGATCGGAGGGTTCGGAAACTGGCTTATCCCACTTATGATCGGCGCGCCAGACATGGCTTTCCCCCGAATGAACAACATAAGCTTCTGACTTCTCCCCCCCTCTTTCCTGCTCCTTCTTGCCTCCTCAGGCGTTGAAGCCGGGGCGGGAACTGGCTGAACAGTCTACCCCCCACTGGCAGGGAATCTAGCGCATGCTGGGGCATCTGTAGACCTAACCATCTTCTCCCTTCACCTTGCAGGCATTTCTTCTATCCTTGGGGCCATCAATTTTATTACTACGATTGTTAATATGAAACCCCCCGCAATTTCACAGTATCAGACTCCTCTATTCGTCTGAGCTGTTCTTATTACAGCCGTCCTCCTTCTTCTGTCCCTCCCCGTCCTTGCCGCCGGCATCACAATGCTCCTAACAGACCGAAACCTCAACACAACCTTCTTTGACCCGGCCGGTGGGGGAGACCCAATCCTTTACCAGCACCTGTTCTGATTCTTC