Pomadasys maculatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Pomadasys maculatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Haemulidae
  • Genus » Pomadasys
  • Species » maculatus
  • Pomadasys maculatus
    (Saddle grunt)
  • Description »  

    Marine; brackish; reef-associated; amphidromous ; depth range 20 - 110 m . Tropical

    Maturity: Lm ?  range ? - ? cm Max length : 59.3 cm TL male/unsexed; ; common length : 30.0 cm TL male/unsexed; ; max. published weight: 3.2 kg

    Dorsal spines (total): 12; Dorsal soft rays (total): 13 - 14; Anal spines: 3; Anal soft rays: 7. Small-sized fish of moderately deep body. Isthmus narrow, forming a groove. Chin with 2 pairs or small pores. This species is characterized by several dark large elongate blotches on the upper back, one forming a saddle on the nape. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_TORL_2207_001A]
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 February 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524586
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:30 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTAGTATTTGGTGCCTGGGCTGGTATGGTAGGCACAGCCCTAAGCCTGCTCATCCGAGCAGAACTTAGCCAACCGGGTGCACTCCTCGGAGACGACCAGATTTATAACGTAATCGTTACTGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCTATCTTAATTGGCGGTTTCGGAAACTGACTCGTACCCCTAATGATTGGGGCACCTGATATAGCGTTCCCTCGGATGAACAACATGAGTTTTTGACTGCTTCCCCCCTCTTTCCTCCTTCTACTTGCCTCTTCAGGAGTTGAGGCTGGGGCCGGAACCGGGTGAACAGTCTACCCTCCTCTTGCCGGTAACCTCGCCCACGCAGGAGCATCAGTTGACCTAACCATCTTCTCCCTTCACTTGGCGGGTGTTTCCTCAATCCTCGGGGCAATTAACTTCATTACGACAATTATCAACATAAAACCCCCTGCAATCTCCCAGTACCAGACCCCTCTTTTCGTCTGATCTGTGCTAGTAACTGCCGTCTTACTGCTACTCTCCCTCCCAGTCCTAGCCGCTGGCATTACAATGCTTCTGACAGACCGAAACCTAAATACTACCTTCTTCGACCCCGCCGGAGGAGGGGATCCAATCCTGTATCAACACCTATGCTGATTCTTC

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2025 - All Rights Reserved. 981 visit(s) today - 749376 total visits (978 average daily visits): 2023-05-22 - 2025-06-26 (766 days)