Leiognathus equula | University of the Philippines Mindanao | Marine Biodiversity Database Project
Leiognathus equula
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Leiognathidae
  • Genus » Leiognathus
  • Species » equula
  • Leiognathus equula
  • Description »  

    Marine; freshwater; brackish; demersal; amphidromous; depth range 10 - 110 m . Tropical; 26°C - 29°C ; 30°N - 36°S, 27°E - 170°W

    Maturity: Lm 10.7  range ? - ? cm Max length : 28.0 cm TL male/unsexed; ; common length : 18.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 15 - 16; Anal spines: 3; Anal soft rays: 14 - 15. This species is distinguished by the following characters: body very deep, compressed, with a strongly humped back; body depth 1.7-1.9 times in standard length; mouth pointing downward when protracted; gill rakers short and fleshy, less than 1/2 length of corresponding gill lamellae, total gill rakers on first gill arch 18-22; head and breast scaleless; tubed scales on lateral line 61-66. Colour of adults, back greyish, belly silvery and many parallel close-set faint bars on back; usually a dark brown saddle on caudal peduncle; axil of pectoral fins grey to black; margin of soft dorsal fin black; both caudal-fin lobes with broad dusky margins; pectoral, pelvic, and anal fins colourless to yellowish. In juveniles (5-7 cm TL), thin, closely arranged, grey vertical lines descending from back to about midheight; membrane between anal-fin spines conspicuously yellow; posterior margin of caudal-fin lobes pale yellow and dusky; other fins hyaline; snout dotted black . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_TORL_2207_002A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:02 July 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524435
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:31 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTTTATATAGTATTTGGTGCTTGAGCTGGAATGGTAGGAACCGCCCTAAGTCTTCTTATTCGGGCAGAGCTAAGCCAGCCAGGTGCTCTGCTCGGAGACGACCACATTTATAATGTTATTGTCACCGCACATGCATTCGTAATAATTTTTTTTATGGTCATACCTATTATGATTGGAGGTTTCGGTAACTGACTAATCCCACTAATAATTGGAGCCCCTGACATAGCATTCCCACGAATGAACAACATAAGTTTCTGACTTCTACCTCCCTCATTCTTACTTCTTTTGGCATCCTCAGGCATTGAAGCTGGAGCAGGAACTGGGTGAACAGTCTACCCCCCTCTTGCAGGCAACCTTGCCCACGCAGGCGCTTCCGTAGACCTGACTATCTTCTCCCTCCACCTAGCCGGAATCTCGTCAATCTTAGGGGCCATTAACTTCATTACAACAATTATTAATATAAAACCCCCAGCCATCTCACAATTCCAAACGCCCCTATTTGTCTGAGCAGTGCTAATCACAGCAGTTCTCCTTCTCCTTTCTCTCCCAGTTCTTGCAGCGGGTATCACAATGCTTCTAACTGACCGTAACCTCAATACTACGTTCTTTGACCCTGCAGGAGGTGGAGACCCAATTTTATATCAACACCTATGTTGATTCTTC