Nemipterus furcosus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Nemipterus furcosus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Nemipteridae
  • Genus » Nemipterus
  • Species » furcosus
  • Nemipterus furcosus
    (Fork-tailed threadfin bream)
  • Description »  

    Marine; brackish; reef-associated; non-migratory; depth range 8 - 110 m . Tropical; 34°N - 26°S, 76°E - 172°E

    Maturity: Lm 16.6, range 13 - ? cm Max length : 24.0 cm SL male/unsexed; ; common length : 18.0 cm SL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 7. Suborbital spine absent. Preopercle with 3 transverse scale rows. Pectoral fins moderately long, reaching to or just short of level of anus. Pelvic fins moderately long, reaching to or just short of level anus. A line drawn up from posterior edge of suborbital reaching the dorsal profile at about the origin of dorsal fin. Females predominate at small sizes while males dominate the larger size classes. Maybe a sequential hermaphrodite. Axillary scale present. Color: Upper body iridescent pink, silvery white below. Lower margin of caudal fin white. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2207_015A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:03 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524518
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 1:02 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTTTATCTCTTATTCGGTGCATGAGCCGGCATGGTCGGAACCGCCCTAAGCCTCCTGATCCGAGCTGAACTCAGCCAACCAGGCGCCCTCCTGGGAGACGACCAAATTTATAACGTCATCGTTACAGCTCACGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAATTGATTAGTACCACTAATGATCGGCGCCCCCGATATAGCATTCCCCCGTATGAACAACATGAGTTTCTGACTCCTCCCCCCTTCATTCCTTCTCCTCCTTGCCTCCTCAGGCATTGAGGCAGGTGCAGGAACAGGCTGAACAGTTTATCCTCCCCTTGCAGGCAATCTAGCACACGCAGGGGCATCTGTAGACTTAACCATTTTTTCTCTTCACCTAGCAGGGATTTCTTCAATCTTAGGAGCTATTAACTTCATTACTACAATTATTAATATGAAACCTCCTGCTATTTCACAATATCAAACACCCCTCTTCGTATGAGCAGTACTAATCACAGCTGTTCTCCTCCTCCTTTCTCTTCCCGTTTTAGCGGCCGGTATTACAATGTTACTAACTGACCGAAACTTAAACACGACTTTCTTTGACCCTGCAGGAGGGGGAGACCCCATCCTTTACCAACATCTCTGCTGATTCTTC