Odontanthias chrysostictus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Odontanthias chrysostictus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Anthiadidae
  • Genus » Odontanthias
  • Species » chrysostictus
  • Odontanthias chrysostictus
  • Description »   (Wikipedia) Odontanthias is a genus of marine ray-finned fish in the family Anthiadidae. Depending on the exact species, they reach up to 10–22 cm (3.9–8.7 in) in standard length, and are brightly marked with pink and yellow. They are found at rocky reefs in deep water, mainly below 100 m (330 ft). The genus is almost entirely restricted to the Indo-Pacific; O. cauoh of the Saint Peter and Saint Paul Archipelago and O. hensleyi of the Caribbean are the only species known from outside the Indo-Pacific and evidence indicates that the latter belongs in Anthias.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2207_010A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524532
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:11 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATTTAGTATTCGGTGCCTGAGCCGGCATAGTAGGCACAGCCTTAAGTCTACTCATTCGAGCAGAACTAAGCCAACCAGGGGCCCTCCTAGGAGATGACCAAATTTATAACGTTATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATTATGATCGGCGGATTTGGTAACTGACTTATCCCACTAATAATCGGCGCCCCTGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCCTGCCACCCTCATTCCTCCTGCTTCTCGCCTCCTCTGGGGTAGAAGCTGGAGCAGGGACTGGATGGACAGTATACCCGCCCCTCGCTGGTAATCTCGCCCACGCAGGGGCCTCTGTTGACTTAACGATTTTCTCCCTACACTTAGCAGGTATTTCCTCTATTCTAGGGGCCATTAACTTTATTACAACTATTGTGAATATGAAACCCCCCGCCATTTCCCAATATCAAACACCACTCTTTGTTTGAGCCGTATTAATTACCGCAGTTCTTCTCCTCTTATCCCTCCCAGTTCTCGCCGCCGGCATTACTATGCTTTTAACAGACCGAAACCTTAATACCACCTTTTTTGACCCTGCTGGGGGAGGAGACCCAATTCTTTACCAACACCTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 393 visit(s) today - 305324 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)