Alectis ciliaris | University of the Philippines Mindanao | Marine Biodiversity Database Project
Alectis ciliaris
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Carangiformes
  • Family » Carangidae
  • Genus » Alectis
  • Species » ciliaris
  • Alectis ciliaris
    (African pompano)
  • Description »   (Wikipedia) The African pompano (Alectis ciliaris), also known as the pennant-fish or threadfin trevally, is a widely distributed species of tropical marine fish in the jack family, Carangidae. The species is found in tropical waters worldwide, with adults often inhabiting coastlines, while juveniles are usually pelagic, floating with ocean currents. The adult African pompano is similar in appearance to the other members of the genus Alectis, with the concave shape of the head near the eyes; the clearest distinguishing feature. The juveniles are similar to other members of Alectis, having long, filamentous dorsal and anal fin tips which are thought to discourage predators. The species lives in depths less than 100 m, consuming a range of crustaceans and small fishes. The species is of minor economic importance, often taken amongst other tropical midwater fishes by hook and line, while juveniles are occasionally caught in beach seines. African pompano are also highly rated game fish, often considered one of the strongest of the jacks in larger sizes.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2207_006A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524240
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 26, 2024, 12:39 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCTTTAAGCCTACTTATCCGAGCAGAACTAAGCCAACCTGGCGCTCTTCTAGGAGACGACCAAATTTATAACGTTATTGTTACGGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTTATCCCATTAATAATTGGAGCCCCTGATATGGCATTCCCCCGAATAAATAACATGAGTTTCTGACTTCTCCCTCCCTCCTTCCTTCTACTTTTAGCCTCTTCAGGGGTTGAAGCTGGGGCTGGGACTGGTTGAACAGTCTACCCTCCACTAGCTGGAAACCTTGCTCACGCCGGGGCATCAGTTGATTTAACCATCTTTTCTCTTCATTTAGCAGGAGTTTCATCAATTTTAGGAGCTATTAATTTTATCACCACTATTATTAACATGAAACCTCCTGCAGTTTCAATATATCAAATCCCACTATTTGTTTGAGCTGTTCTGATTACAGCCGTCCTTCTCCTTCTATCCCTTCCAGTCCTAGCTGCCGGCATTACAATGCTTCTAACAGATCGAAACCTAAATACTGCCTTCTTTGACCCAGCACGAGGTGGGGACCCCATCCTTTATCAACACTTATTTTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 242 visit(s) today - 171306 total visits (345 average daily visits): 2023-05-22 - 2024-09-29 (496 days)