Monotaxis grandoculis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Monotaxis grandoculis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Lethrinidae
  • Genus » Monotaxis
  • Species » grandoculis
  • Monotaxis grandoculis
    (Humpnose big-eye bream)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 0 - 100 m , usually 5 - 30 m . Tropical; 35°N - 30°S, 32°E - 122°W

    Maturity: Lm 30.3, range 18 - ? cm Max length : 60.0 cm TL male/unsexed; ; common length : 40.0 cm TL male/unsexed; ; max. published weight: 5.9 kg

    Dorsal spines (total): 10; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9. This species is distinguished by the following characters: body oblong, greatest body depth of adults about 2.2 in SL; head profile strongly convex in front of eye, the snout sloping steeply; eye large 2.7 (juveniles) to 3.8 (adults) in HL; inner surface of the pectoral fin base is densely scaled; pectoral rays usually 14; caudal fin forked with pointed tips; lateral line scales 44-47; scale rows above lateral line (to base of middle dorsal spines) 5, below (to origin of anal fin) 13.5; side of jaw with row of 5-7 molariform teeth. Color of adult silvery grey with narrow dark scale margins, lips yellowish, a large black blotch covering pectoral fin axil, quick to assume pattern of 4 broad, blackish bars on body, the pale interspaces covering 3-4 scale rows; juveniles with black bar through eye, body with 3 dark brown to blackish bars with the 2 posterior bars extending onto the dorsal fin, and each lobe of caudal fin with an orange band ( Ref. 2295, 90102). Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1902_GOVG_026A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:09 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524487
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:11 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATTTAGTATTCGGTGCCTGAGCCGGAATAGTCGGCACCGCCTTAAGCCTGCTCATTCGAGCAGAGCTGAGTCAACCAGGCGCCCTTCTGGGGGACGACCAGATTTATAATGTTATCGTTACGGCACACGCCTTCGTGATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTTGGCAACTGACTCATTCCCCTAATAATTGGAGCTCCTGACATGGCATTCCCTCGAATGAATAACATGAGCTTCTGACTTCTTCCCCCCTCCTTCCTTCTTCTCCTAGCCTCCTCAGGCGTAGAAGCCGGAGCAGGAACCGGATGAACGGTTTACCCTCCACTAGCAGGCAATCTTGCCCACGCAGGAGCATCCGTGGACCTGACCATCTTCTCCCTCCACCTGGCTGGTGTTTCTTCTATTCTAGGGGCAATTAACTTTATTACAACCATTATCAACATGAAACCCCCTGCTATCTCCCAATACCAGACGCCATTATTTGTGTGAGCGGTCCTAATTACTGCCGTACTACTTCTTCTCTCACTCCCAGTCCTGGCTGCAGGCATTACAATGCTCCTTACCGACCGAAATCTAAACACAACTTTCTTTGACCCAGCAGGGGGAGGTGACCCAATTCTCTACCAGCACCTATATTGA