Lutjanus decussatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lutjanus decussatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Lutjanidae
  • Genus » Lutjanus
  • Species » decussatus
  • Lutjanus decussatus
    (Checkered snapper)
  • Description »  

    Marine; reef-associated; depth range 0 - 50 m . Tropical; 31°N - 19°S, 75°E - 142°E

    Maturity: Lm ?  range ? - ? cm Max length : 35.0 cm TL male/unsexed; ; common length : 25.0 cm SL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 13 - 14; Anal spines: 3; Anal soft rays: 8 - 9. This species is distinguished by the following characters: body moderately deep, its depth 2.6-3.1 in SL; preopercular notch and knob poorly developed; vomerine tooth patch crescentic, without a medial posterior extension; tongue with a patch of granular teeth; gill rakers of first gill arch 6 + 8-10 = 14-16. Colour generally whitish, with a `checker-board' pattern on upper half of sides, with dark brown bars and stripes, surrounding rectangular, whitish 'windows'; horizontal brown stripes 5-6, 2 on lower half of sides; caudal fin base with large black spot. ( Ref. 9821, 90102)
    Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1908_GOVG_037A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 February 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524464
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:12 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTTGTATTCGGTGCTTGAGCTGGTATAGTCGGCACAGCCCTAAGCCTGCTCATTCGAGCAGAGCTAAGCCAACCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCGTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGATTTGGAAACTGACTAATCCCACTAATGATCGGAGCCCCTGACATGGCATTCCCCCGAATGAACAACATGAGCTTTTGACTCCTTCCCCCCTCATTCCTACTGCTGCTAGCCTCCTCAGGGGTAGAAGCCGGCGCTGGAACTGGATGAACAGTGTACCCCCCTCTAGCAGGAAACCTTGCACACGCAGGAGCATCTGTTGACCTCACCATCTTCTCCCTCCATCTAGCAGGTGTTTCTTCAATTCTAGGGGCCATCAATTTTATTACAACAATTATTAATATGAAACCCCCTGCCATCTCTCAATACCAAACACCTCTATTCGTCTGAGCCGTTCTAATCACCGCTGTGCTGCTTCTTCTTTCTCTCCCAGTCCTAGCTGCCGGAATTACAATGCTTCTCACAGATCGAAACCTGAACACTACTTTCTTTGATCCCGCAGGAGGAGGGGACCCCATCCTCTACCAGCACCTATTCTGA