Parupeneus indicus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus indicus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » indicus
  • Parupeneus indicus
    (Indian goatfish)
  • Description »  

    Marine; brackish; reef-associated; depth range 10 - 30 m . Tropical; 19°N - 23°S, 28°E - 150°W

    Maturity: Lm ?  range ? - ? cm Max length : 45.0 cm TL male/unsexed; ; common length : 35.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7. Diagnosis: Pectoral rays 16 (rarely 15 or 17). Gill rakers 5-7 + 18-21 (total 24-27)> Body depth 3.25-3.75 in SL; head length (HL) 2.9-3.25 in SL; snout length 1.65-1.95 in HL; barbel length 1.3-1.5 in HL. Longest dorsal spine 1.5-1.8 in HL; penultimate dorsal ray about equal to last dorsal ray in juveniles, 1.05-1.2 in length of last dorsal ray of adults; pectoral-fin length 1.35-1.55 in HL; pelvic-fin length 1.3-1.5 in HL. Body greenish brown to reddish brown dorsally, the scale edges narrowly dark, shading to whitish or pale pink ventrally, with a nearly round black spot as large or larger than eye on side of caudal peduncle, two-thirds of which lies above the lateral line; a large, horizontally elongate yellow spot (sometimes partly white) on lateral line below interdorsal space; barbels white; irregular pale blue lines extending anteroventrally and dorsoposteriorly from eye; second dorsal and anal fins with irregular oblique pale blue lines; caudal fin yellowish gray with faint blue lines paralleling rays; peritoneum dark brown (pale brown to white in other species of the genus except Parupeneus barberinus) . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1908_GOVG_045A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524554
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:12 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTACCTAGTCTTTGGTGCCTGAGCCGGAATGGTAGGAACTGCTTTAAGCCTTCTTATTCGTGCCGAGCTCAGCCAACCCGGCGCTCTTTTAGGTGACGACCAAATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATGGTAATGCCAATTATGATTGGAGGGTTCGGTAACTGACTTATTCCACTCATGATCGGGGCACCCGACATGGCTTTCCCTCGAATGAACAACATGAGCTTCTGGCTACTCCCTCCCTCTTTCCTGCTTCTTCTTGCCTCTTCAGGTGTTGAAGCTGGGGCCGGAACTGGTTGAACGGTCTACCCTCCACTTGCAGGTAATCTAGCACATGCCGGAGCATCTGTTGACCTAACTATCTTCTCCCTCCACCTTGCAGGTATTTCTTCAATCCTGGGAGCTATTAATTTTATTACTACAATTATTAATATGAAACCCCCTGCAATTTCACAATACCAGACACCTCTGTTCGTCTGAGCTGTGTTAATTACAGCCGTGCTACTCCTTCTGTCACTTCCAGTCCTTGCCGCTGGCATTACAATGCTACTCACGGACCGAAACCTAAATACAACTTTCTTCGACCCGGCAGGCGGGGGAGACCCAATCCTTTACCAACACCTGTTCTGA