Epinephelus quoyans | University of the Philippines Mindanao | Marine Biodiversity Database Project
Epinephelus quoyans
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Epinephelus
  • Species » quoyanus
  • Epinephelus quoyans
  • Description »   (Wikipedia) Epinephelus is a genus of marine ray-finned fish, groupers from the subfamily Epinephelinae, part of the family Serranidae, which also includes the anthias and sea basses. They are predatory fish, largely associated with reefs and are found in tropical and subtropical seas throughout the world. They are important target species for fisheries.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   MIN_1908_STAC_003A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:23 November 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524390
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 5:03 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTTGTATTTGGTGCCTGGGCTGGCATAGTAGGAACAGCCCTAAGCCTTCTTATTCGGGCTGAGCTGAGCCAACCAGGAGCTTTGCTCGGCGATGATCAGATCTATAATGTAATTGTCACAGCGCATGCGTTTGTAATAATTTTTTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGGCTCATTCCTCTTATAATTGGCGCCCCAGACATAGCATTCCCTCGAATAAATAATATAAGTTTCTGACTTCTCCCTCCATCCTTCCTACTTCTTCTAGCTTCTTCTGGAGTAGAGGCTGGTGCCGGTACTGGCTGAACAGTATATCCACCTCTAGCTGGGAACCTGGCCCATGCAGGTGCATCAGTAGACTTAACTATTTTCTCACTACATTTAGCAGGAATCTCATCAATTCTAGGGGCTATTAACTTTATTACAACTATTATTAACATAAAACCTCCCGCCATTTCACAATATCAGACACCTCTATTCGTGTGGGCCGTCTTAATTACAGCAGTATTACTACTCCTTTCTCTCCCTGTCCTTGCCGCCGGTATTACAATACTTTTAACAGATCGTAATCTCAATACTACCTTCTTTGACCCAGCTGGAGGGGGAGATCCTATTCTTTACCAACATCTATTTTGA

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 48 visit(s) today - 304979 total visits (552 average daily visits): 2023-05-22 - 2024-11-24 (552 days)