Epinephelus quoyans | University of the Philippines Mindanao | Marine Biodiversity Database Project
Epinephelus quoyans
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Serranidae
  • Genus » Epinephelus
  • Species » quoyanus
  • Epinephelus quoyans
  • Description »  

    Marine; reef-associated; depth range ? - 50 m . Tropical; 35°N - 32°S, 110°E - 156°E

    Maturity: Lm ?, range 18 - ? cm Max length : 40.0 cm TL male/unsexed;

    Dorsal spines (total): 11; Dorsal soft rays (total): 16 - 18; Anal spines: 3; Anal soft rays: 8. Distinguished by the following characteristics: whitish color; head, body and fins with numerous large close-set hexagonal to roundish dark brown to blackish spots; ctenoid body scales except cycloid dorsoanteriorly above lateral line, on thorax and abdomen; body with auxiliary scales; greatest depth of body 2.7-3.2 in SL; rounded caudal fin; pelvic fins, 1.7-2.1 in head length ; head length 2.3-2.6 times in SL; evenly curved dorsal head profile; snout subequal to eye diameter, snout length 4.6-5.3 times in HL; rounded preopercle or subangular; upper edge of operculum almost straight; posterior nostril diameter about twice that of anterior nostrils; maxilla reaches to or past vertical at rear edge of eye; 2-3 rows of teeth on midlateral part of lower jaw; lower jaw barely projecting in front of upper jaw . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1908_STAC_003A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:23 November 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524390
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 5:03 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTTGTATTTGGTGCCTGGGCTGGCATAGTAGGAACAGCCCTAAGCCTTCTTATTCGGGCTGAGCTGAGCCAACCAGGAGCTTTGCTCGGCGATGATCAGATCTATAATGTAATTGTCACAGCGCATGCGTTTGTAATAATTTTTTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGGCTCATTCCTCTTATAATTGGCGCCCCAGACATAGCATTCCCTCGAATAAATAATATAAGTTTCTGACTTCTCCCTCCATCCTTCCTACTTCTTCTAGCTTCTTCTGGAGTAGAGGCTGGTGCCGGTACTGGCTGAACAGTATATCCACCTCTAGCTGGGAACCTGGCCCATGCAGGTGCATCAGTAGACTTAACTATTTTCTCACTACATTTAGCAGGAATCTCATCAATTCTAGGGGCTATTAACTTTATTACAACTATTATTAACATAAAACCTCCCGCCATTTCACAATATCAGACACCTCTATTCGTGTGGGCCGTCTTAATTACAGCAGTATTACTACTCCTTTCTCTCCCTGTCCTTGCCGCCGGTATTACAATACTTTTAACAGATCGTAATCTCAATACTACCTTCTTTGACCCAGCTGGAGGGGGAGATCCTATTCTTTACCAACATCTATTTTGA