Sargocentron caudimaculatum | University of the Philippines Mindanao | Marine Biodiversity Database Project
Sargocentron caudimaculatum
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Holocentriformes
  • Family » Holocentridae
  • Genus » Sargocentron
  • Species » caudimaculatum
  • Sargocentron caudimaculatum
    (Silverspot squirrelfish)
  • Description »   (Wikipedia) Sargocentron caudimaculatum, the silverspot squirrelfish or whitetail squirrelfish, is a reef-associated member of the family Holocentridae. It is native to the Indian and Pacific Oceans from East Africa to Japan and northern Australia and as far east as the Marshall Islands. It lives near reefs, but can also be found in lagoons and drop-offs at depths between 2 and 40 metres (6.6 and 131.2 ft). It is a nocturnal predator, feeding primarily on crabs and shrimps. It can reach sizes of up to 25.0 centimetres (9.8 in) TL. Although it is caught commercially and can be found in the aquarium trade, there are no known major threats to this species.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2204_004A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524618
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 5:01 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGTACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCTGGAGCTCTCCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAACTGACTAATCCCCCTAATGATTGGAGCCCCTGACATAGCATTCCCTCGGATAAATAACATAAGCTTTTGACTATTACCCCCATCATTCCTCCTTCTACTAGCCTCTTCCGGAGTAGAAGCTGGTGCCGGTACAGGATGAACAGTATACCCACCCCTTGCAGGTAATTTAGCCCACGCAGGGGCTTCTGTTGACCTTACTATCTTCTCACTCCATCTAGCAGGTATTTCTTCAATTCTTGGGGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCTGCCATTTCCCAATACCAAACTCCCCTATTTGTATGAGCCGTTCTCATCACAGCTGTCCTTCTACTTCTATCCCTACCCGTGCTCGCAGCAGGAATTACCATGCTACTAACAGACCGAAACCTAAACACAACATTCTTCGACCCAGCAGGAGGTGGAGACCCAATCCTTTACCAACACTTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1045 visit(s) today - 304531 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)