Sargocentron caudimaculatum | University of the Philippines Mindanao | Marine Biodiversity Database Project
Sargocentron caudimaculatum
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Holocentriformes
  • Family » Holocentridae
  • Genus » Sargocentron
  • Species » caudimaculatum
  • Sargocentron caudimaculatum
    (Silverspot squirrelfish)
  • Description »  

    Marine; reef-associated; depth range 2 - 40 m . Tropical; 32°N - 24°S

    Maturity: Lm ?  range ? - ? cm Max length : 25.0 cm TL male/unsexed; ; common length : 18.0 cm TL male/unsexed;

    Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 15; Anal spines: 4; Anal soft rays: 8 - 9. Head and body red, edges of scales silver; silvery white spot anterodorsally on caudal peduncle (often disappears after death); spinous part of dorsal fin mottled light red, the outer part of the membranes bright red . 4-5 oblique rows of scales on cheek. Body depth 2.3-2.7 in SL; head length 2.3-2.8 in SL; snout length 3.6-4.0 in head length. Maxilla extending posteriorly from front of pupil to the center of eye; upper jaw length 2.7-2.95 in head length; premaxillary groove reaching about front edge of orbit; anterior end of nasal bone with 2 short diverging spines; spine at edge of premaxillary groove absent; anterior edge of nasal fossa with 1 (rarely 2) spinule; upper edge of first suborbital bone not serrated . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2204_004A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524618
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 5:01 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGTACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCTGGAGCTCTCCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAACTGACTAATCCCCCTAATGATTGGAGCCCCTGACATAGCATTCCCTCGGATAAATAACATAAGCTTTTGACTATTACCCCCATCATTCCTCCTTCTACTAGCCTCTTCCGGAGTAGAAGCTGGTGCCGGTACAGGATGAACAGTATACCCACCCCTTGCAGGTAATTTAGCCCACGCAGGGGCTTCTGTTGACCTTACTATCTTCTCACTCCATCTAGCAGGTATTTCTTCAATTCTTGGGGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCTGCCATTTCCCAATACCAAACTCCCCTATTTGTATGAGCCGTTCTCATCACAGCTGTCCTTCTACTTCTATCCCTACCCGTGCTCGCAGCAGGAATTACCATGCTACTAACAGACCGAAACCTAAACACAACATTCTTCGACCCAGCAGGAGGTGGAGACCCAATCCTTTACCAACACTTATTCTGATTCTTC