Sargocentron diadema | University of the Philippines Mindanao | Marine Biodiversity Database Project
Sargocentron diadema
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Holocentriformes
  • Family » Holocentridae
  • Genus » Sargocentron
  • Species » diadema
  • Sargocentron diadema
    (Crown squirrelfish)
  • Description »  

    Marine; reef-associated; depth range 1 - 60 m , usually 2 - 30 m . Tropical; 30°N - 33°S, 27°E - 128°W

    Maturity: Lm ?  range ? - ? cm Max length : 17.0 cm TL male/unsexed;

    Dorsal spines (total): 11; Dorsal soft rays (total): 12 - 14; Anal spines: 4; Anal soft rays: 8 - 9. Body with alternating broad red and narrower silvery white stripes ; red head with 2 vertical white streaks on the opercle, one on its edge and an oblique one below the eye; distinctive reddish-black to black dorsal fin with two white streaks. Five or 6 oblique rows of scales on cheek. Maxilla nearly reaching or extending slightly beyond a vertical at anterior edge of the pupil; upper jaw length 2.75-2.95 in head length. Body depth 2.75-3.25 in SL; head length 2.7-3.15 in SL; snout length 4.0-4.4 in head length; interorbital width 4.4-4.9 in head length; premaxillary groove extending slightly posterior to a vertical at anterior edge of orbit; anterior end of nasal bone rounded; medial margin of nasal bone without spinule; nasal fossa without spinules on its edge; upper edge of suborbital bones below anterior half of eye spineless; small preopercular spine, its length 2-3 times in orbit diameter, 2.85-3.5 in head length; longest 4th dorsal spines, 1.7-2.25 in head length; third anal spine 1.2-1.35 in head length . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Maria, Davao Occidental] [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1910_STAM_035A] [FDP_STAC_2209_023A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524621
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:14 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCCGGAGCCCTTCTGGGGGACGACCAGATTTATAATGTCATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGGAACTGATTAATTCCTTTAATGATCGGAGCCCCCGATATGGCATTCCCTCGAATGAACAACATAAGCTTCTGACTTCTTCCTCCCTCATTCCTGCTTTTATTAGCTTCTTCCGGAGTTGAAGCTGGTGCCGGAACGGGATGAACGGTATATCCACCTCTAGCAGGCAACCTGGCACACGCAGGAGCTTCTGTCGACCTAACTATTTTCTCACTCCACCTAGCAGGGATTTCCTCAATTCTAGGAGCCATTAATTTTATTACAACAATTATTAACATGAAACCCCCTGCCATTTCCCAATATCAAACACCTCTGTTTGTATGAGCTGTCCTAATTACAGCAGTACTTCTCCTTCTCTCCCTGCCCGTACTCGCAGCAGGCATTACTATGCTACTAACAGACCGAAACCTAAATACAACATTCTTCGACCCAGCAGGAGGTGGAGACCCAATTCTTTATCAACACCTATTCTGA