Cheilinus trilobatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Cheilinus trilobatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Labridae
  • Genus » Cheilinus
  • Species » trilobatus
  • Cheilinus trilobatus
    (Tripletail wrasse)
  • Description »  

    Marine; brackish; reef-associated; depth range 1 - 30 m . Tropical; 30°N - 28°S, 32°E - 139°W

    Maturity: Lm ?, range 26 - ? cm Max length : 45.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body moderately deep, its depth 2.3-2.6 times in standard length; dorsal profile of head convex; anterior tip of snout forming an acute angle; jaws prominent, 2 strong canines situated anteriorly in each jaw; no enlarged tooth present of rear of upper jaw. D IX,10, the spines and anterior soft rays of similar length; A III,8; pectoral fins with ii unbranched and 10 branched rays; pelvic fins long, reaching anus in small fish, well beyond in adults; centre of caudal fin rounded in adults, with the upper and lower rays forming elongate lobes giving the fin a trilobed appearance; lateral line interrupted below posterior portion of dorsal-fin base, with a total of 22-23 pored scales; scales reaching well onto bases of dorsal and anal fins; scales in front of dorsal fin extending forward to above centre of eye; cheek and opercle scaly; lower jaw without scales. Colour of the body variably pigmented from green to brown with mottled purple and red markings; 4 vertical dark bars on body that are often indistinct on large individuals; head with numerous small red spots; red lines radiating from anterior and posterior of eye; scales on sides each with a vertical, slightly curved red line; dorsal, anal, and pectoral fins yellow or green with distal red streaks; caudal fin green with a red posterior margin; juveniles with 3-4 dark spots midlaterally on sides and more prominent dark bars. This species capable of rapid colour changes . Body shape (shape guide): short and / or deep;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur] [Toril, Davao City, Davao del Sur] [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1908_STAC_007A] [FDP_TORL_2206_019A] [FDP_SGES_2112_014A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 February 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524329
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:29 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGTACTGCCCTTAGCTTACTCATCCGAGCGGAACTCAGTCAACCCGGTGCTCTACTCGGAGACGACCAGATCTATAATGTAATCGTAACAGCCCATGCTTTCGTTATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGTTTCGGAAACTGACTAATCCCCCTTATGATTGGCGCCCCCGACATAGCCTTTCCTCGTATAAACAACATGAGCTTTTGACTCCTCCCTCCGTCCTTCCTCCTTCTCCTTGCATCCTCTGGCGTAGAAGCAGGGGCCGGCACAGGTTGAACAGTTTACCCCCCGTTAGCCGGAAATTTAGCCCATGCAGGTGCATCAGTAGATTTGACAATCTTCTCCCTTCACCTTGCCGGGATCTCGTCAATTCTAGGGGCCATTAATTTCATTACAACTATCATTAACATGAAACCCCCAGCCATTACTCAGTATCAGACCCCCTTATTCGTCTGAGCAGTTCTCATCACAGCCGTCCTTCTACTTCTATCTCTCCCTGTCCTCGCTGCAGGCATTACAATGCTTTTAACGGACCGTAACCTAAACACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCCATTCTCTACCAGCACCTATTCTGA