Plectorhinchus chaetodonoides | University of the Philippines Mindanao | Marine Biodiversity Database Project
Plectorhinchus chaetodonoides
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Haemulidae
  • Genus » Plectorhinchus
  • Species » chaetodonoides
  • Plectorhinchus chaetodonoides
    (Harlequin sweetlips)
  • Description »  

    Marine; brackish; reef-associated; depth range 1 - 30 m . Tropical; 31°N - 23°S, 57°E - 144°W

    Maturity: Lm ?, range 40 - ? cm Max length : 72.0 cm TL male/unsexed; ; common length : 60.0 cm SL male/unsexed; ; max. published weight: 7.0 kg

    Dorsal spines (total): 11 - 12; Dorsal soft rays (total): 18 - 20; Anal spines: 3; Anal soft rays: 7 - 9. This species is distinguished by the following characters: chin with 6 pores, no median pit; gill rakers on first gill arch 9-12 + 1 + 27-32 = 36-43; D XII (rarely XI),18-20; longest dorsal-fin ray 16-25% of standard length, almost equal to length of soft dorsal-fin base in small specimens, more than 1/2 length of soft dorsal-fin base in adults; lips fleshy, moderately swollen with age; scales ctenoid (rough to touch); lateral line tubed scales about 52-59; body depth 2.4-2.5 in SL; caudal fin deeply forked with broadly rounded lobes in juveniles; only slightly forked to emarginate in adults. Colour of body with numerous dark brown spots, generally larger than pupil; pelvic fins spotted, darkening with age; juveniles brownish with large, well-defined creamy white blotches on body that include brown spots with age; colour gradually changing into a greyish background with large, deep brown spots ( Ref. 47695, 90102). Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2204_002A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:12 April 2023 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524568
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 4:56 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTAGTATTCGGTGCTTGAGCTGGAATAGTGGGAACGGCCTTAAGCCTGCTCACCCGGGCAGAATTAAGCCAACCCGGCGCTCTCCTAGGAGACGACCAGATTTACAATGTTATTGTTACGGCGCACGCGTTCGTAATAATCTTCTTTATGGTAATACCAATCCTGATCGGAGGGTTCGGAAACTGACTGGTCCCACTAATAATCGGAGCGCCTGACATGGCATTCCCCCGAATAAACAATATGAGCTTCTGACTTCTCCCACCATCCTTCCTTCTCCTCCTTGCCTCCTCAGGCGTAGAAGCCGGAGCAGGAACTGGTTGAACAGTTTACCCCCCATTGGCCGGTAATCTGGCGCACGCAGGTGCATCTGTTGACCTAACAATCTTTTCCCTTCATCTGGCCGGTATCTCCTCAATTCTTGGAGCAATCAATTTTATTACAACAATTATTAACATGAAGCCCCCTGCAATTTCACAATATCAAACCCCCCTATTCGTCTGATCAGTCCTAGTGACCGCTGTCCTTCTGCTCCTCTCCCTCCCAGTCCTTGCTGCCGGAATTACAATGCTCCTCACAGATCGAAACCTTAACACTACCTTCTTTGATCCTGCATGAGGAGGAGACCCAATTCTCTATCAACACCTGTTCTGATTCTTC