Thalassoma hardwicke | University of the Philippines Mindanao | Marine Biodiversity Database Project
Thalassoma hardwicke
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Thalassoma
  • Species » hardwicke
  • Thalassoma hardwicke
    (Sixbar wrasse)
  • Description »   (Wikipedia) The sixbar wrasse or six-banded wrasse (Thalassoma hardwicke) is a species of wrasse in the family Labridae, native to the Indian Ocean and the western Pacific Ocean. It is an inhabitant of reef environments at depths from the surface down to 15 m (50 ft). This species can grow to 20 cm (8 in) in total length, though most individuals do not exceed 15 cm (6 in). It is of minor importance to local commercial fisheries and can also be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur] [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   MIN_1908_STAC_009A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524696
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 8:36 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTATCTTGTGTTCGGCGCATGAGCCGGAATAGTGGGTACAGCCCTGAGCCTGCTCATTCGAGCAGAGCTAAGCCAGCCCGGCGCCCTCCTTGGGGACGATCAGATCTATAACGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGGATGAACAACATAAGCTTTTGACTCCTTCCCCCTTCATTCCTTCTCCTCCTTGCCTCTTCTGGCGTTGAAGCGGGAGCCGGAACCGGATGAACGGTTTACCCGCCTTTAGCAGGTAATCTTGCCCACGCTGGCGCATCCGTTGACCTTACTATTTTTTCATTACACCTAGCGGGTATCTCCTCAATCCTCGGTGCAATTAACTTCATTACAACCATTATTAATATGAAGCCCCCAGCCATCTCACAATACCAAACGCCTCTTTTCGTGTGAGCCGTTCTAATTACAGCAGTCCTTCTTCTCCTCTCCCTTCCGGTTCTGGCTGCTGGAATTACAATGCTCCTAACGGACCGAAATCTAAACACCACCTTCTTTGACCCTGCTGGAGGAGGGGACCCAATTCTTTACCAACATCTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1276 visit(s) today - 303373 total visits (552 average daily visits): 2023-05-22 - 2024-11-22 (550 days)