Lethrinus olivaceus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lethrinus olivaceus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Lethrinidae
  • Genus » Lethrinus
  • Species » olivaceus
  • Lethrinus olivaceus
    (Longface emperor)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 1 - 185 m . Tropical; 33°N - 35°S, 33°E - 135°W

    Maturity: Lm ?, range 34 - ? cm Max length : 100.0 cm TL male/unsexed; ; common length : 70.0 cm TL male/unsexed; ; max. published weight: 14.0 kg

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body moderately slender, its depth 2.9-3.4 times in standard length; head length 1.1-1.3 times in body depth, 2.4-2.9 times in SL, dorsal profile near eye nearly straight or with small bump; snout length about 1.7-2.2 times in HL, measured without the lip the snout is 0.6-0.8 times in cheek height, its dorsal profile slightly concave, snout angle relative to upper jaw between 40° and 50°; interorbital space convex to flat; posterior nostril a longitudinal oblong opening, closer to orbit than anterior nostril; eye situated close to or not close to dorsal profile, its length 3.4-6.2 times in HL; cheek height 3 to 3.8 times in HL; lateral teeth in jaws conical; outer surface of maxilla smooth; D X, 9 with the 3rd or 4th dorsal-fin spine the longest, its length 2.4-2.8 times in body depth; A III,8 with the first soft ray usually the longest, its length almost equal to or slightly shorter than length of base of soft-rayed portion of anal fin and 1.3-1.7 times in length of entire anal-fin base; pectoral-fin rays 13; pelvic-fin membranes between rays closest to body with dense melanophores; cheek without scales; 46-48 lateral-line scales; 5 ½ scale rows between lateral line and base of middle dorsal-fin spines; usually 16-17 scale rows in transverse series between origin of anal fin and lateral line; 15 rows in lower series of scales around caudal peduncle; 6-9 scales in supratemporal patch; inner surface of pectoral-fin base without scales; posterior angle of operculum fully scaly. Colour of body grey, lighter ventrally, often with scattered irregular dark blotches; snout with wavy dark streaks, upper jaw, especially near corner of mouth sometimes edged behind with red . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental] [Santa Cruz, Davao del Sur] [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2202_048A] [MIN_1811_STAC_054A] [FDP_GOVG_2208_026A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:09 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524452
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:10 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTATATTTAGTATTTGGTGCTTGAGCTGGCATAGTAGGGACGGCCCTGAGCCTACTTATCCGTGCAGAACTAAGCCAACCTGGAGCACTCCTGGGAGACGACCAGATTTATAATGTTATCGTCACAGCACATGCTTTTGTAATAATTTTCTTTATAGTAATGCCTCTTATGATCGGAGGCTTCGGCAATTGACTGATCCCCCTAATGATTGGGGCTCCCGATATGGCATTCCCTCGAATAAACAATATGAGCTTTTGACTCTTACCCCCCTCATTCCTCCTTCTCCTAGCATCCTCAGGTGTAGAAGCCGGGGCGGGCACTGGGTGGACAGTCTACCCCCCACTAGCGGGAAATCTCGCCCATGCAGGTGCATCTGTGGATCTAACAATTTTCTCACTTCACTTAGCAGGGGTGTCCTCAATTCTAGGGGCTATCAACTTCATTACGACAATTATTAATATAAAACCTCCGGCCGTCTCTCAGTACCAAACACCCCTATTCGTTTGAGCTGTTCTGATCACTGCCGTGCTTCTTCTTCTGTCCCTACCAGTTCTTGCCGCCGGGATCACAATGCTTCTAACAGACCGAAACTTAAATACTACTTTTTTTGATCCCGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTCTGCTGATTCTTC