Parupeneus barberinus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus barberinus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » barberinus
  • Parupeneus barberinus
    (Dash-and-dot goatfish)
  • Description »  

    Marine; reef-associated; depth range 0 - 100 m . Tropical; 34°N - 34°S, 22°E - 134°W

    Maturity: Lm 19.2, range 13 - ? cm Max length : 60.0 cm TL male/unsexed; ; common length : 30.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7. This species is distinguished by the following characters: pectoral rays 16-18 (usually 17); gill rakers 6-7 + 20-25 = 26-31; body moderately elongate, depth 3.3-3.7 in SL; head length (HL) 2.6-3.0 in SL; snout length 1.45-2.1 in HL (relatively longer with growth); barbel length 1.4-1.6 in HL; longest dorsal spine 1.15-1.75 in HL (longer with growth); penultimate dorsal soft ray about equal to last ray in young, 1.2 in last ray in large adults; pectoral fins 1.5-1.75 in HL; pelvic fins 1.35-1.6 in HL. Colour of body whitish with a dark brown to black stripe (red on fish in deeper water) from upper lip through eye to below posterior part of second dorsal fin or anteriorly on upper caudal peduncle; body above stripe yellow or yellowish gray; body below whitish, scale edges narrowly gray to brownish red; a black or red spot larger than eye at the midbase of caudal fin; some large adults with centers of scales below dark stripe pale blue, the edges yellow or with yellow spots, especially posteriorly; peritoneum dark brown . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur] [Sasa, Davao City, Davao Del Sur] [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1908_STAC_023A] [FDP_IGCS_2111_018A] [FDP_SGES_2112_003B]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524549
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:04 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTACCTAGTCTTTGGTGCCTGAGCCGGAATGGTAGGAACTGCTTTAAGCCTCCTTATTCGTGCCGAGCTCAGCCAACCCGGCGCTCTTTTAGGTGACGACCAAATTTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATGGTAATGCCAATTATGATTGGAGGGTTCGGTAACTGACTTATTCCACTCATGATCGGAGCACCCGACATGGCTTTCCCTCGAATGAACAACATGAGCTTCTGGCTACTCCCTCCCTCTTTCCTACTTCTTCTTGCCTCTTCAGGTGTTGAAGCTGGGGCCGGAACTGGTTGAACAGTCTATCCCCCACTAGCAGGTAATCTAGCACATGCCGGAGCATCTGTCGACCTAACTATCTTCTCCCTCCACCTCGCAGGTATTTCTTCAATTCTAGGGGCTATTAATTTTATTACTACAATTATTAATATGAAACCCCCTGCAATTTCACAATACCAGACACCACTGTTCGTCTGAGCTGTATTAATTACAGCCGTGCTGCTCCTTCTGTCACTTCCAGTCCTTGCCGCTGGCATTACAATGCTACTCACAGATCGAAACCTAAATACAACTTTCTTCGACCCGGCAGGCGGGGGAGACCCAATCCTTTACCAACATCTGTTCTGA