Platax orbicularis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Platax orbicularis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Moroniformes
  • Family » Ephippidae
  • Genus » Platax
  • Species » orbicularis
  • Platax orbicularis
    (Orbicular batfish)
  • Description »  

    Marine; brackish; reef-associated; depth range 0 - 30 m . Tropical; 22°C - 28°C; 32°N - 35°S, 20°E - 130°W

    Maturity: Lm ?  range ? - ? cm Max length : 60.0 cm TL male/unsexed;

    Dorsal spines (total): 5; Dorsal soft rays (total): 34 - 39; Anal spines: 3; Anal soft rays: 25 - 29. The ocular band of adult specimens with a series of dark vermiculations . Adults (above 20 cm) yellowish silvery or dusky, dark bar through eye and another bar just behind head. Occasionally with a few small, scattered black spots on body. Median fins yellowish, with black margins posteriorly. Pelvic fins black. Small juveniles reddish brown, with irregular black spots and blotches and small, white (black-edged) ocelli on body. Small black spot at base of last 3 dorsal- and anal-fin rays. Caudal fin transparent except for base, which is reddish brown. Body orbicular and strongly compressed, its depth more than twice length of head and 0.9 to 1.4 times SL. Head length 3.4 to 3.8 times SL. Snout profile of large adults (above 40 cm total length) concave, with bony swelling between eyes. Interorbital width 38 to 48% head length. Jaws with bands of slender, flattened, tricuspid teeth, the middle cusp about twice length of lateral cusps. No teeth on palatines or vomer. Five pores on each side of lower jaw. Preopercle smooth. Opercle without spines . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1908_STAC_041A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:12 October 2018 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524565
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 3:54 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGCATAGTAGGCACAGCACTAAGCCTGCTTATCCGAGCAGAGCTAAACCAACCAGGCGCTCTCCTTGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCGTTCGTAATAATTTTCTTTATAGTCATGCCAGTAATGATCGGGGGCTTTGGAAATTGACTAATCCCACTAATAATCGGCGCCCCAGACATGGCTTTCCCTCGAATGAACAACATAAGCTTCTGACTCCTTCCCCCCTCATTCCTCCTGCTCCTCGCCTCTTCCGGAGTAGAAGCTGGTGCTGGAACTGGCTGAACTGTTTACCCGCCGCTAGCCAGCAACCTGGCACATGCAGGCGCATCTGTAGACCTGACTATTTTCTCCCTACATTTAGCAGGTATCTCCTCAATTCTAGGGGCTATTAACTTTATCACAACAATTATTAACATAAAACCCCCCGCCATTTCCCAATATCAAACCCCCCTGTTCGTCTGAGCCGTCCTAATTACGGCTGTCCTCTTACTCCTTTCACTTCCCGTCCTCGCCGCGGGCATTACTATGCTACTTACAGATCGAAATCTAAACACCACCTTTTTCGACCCGGCAGAAGGAGGAGACCCAATTCTCTATCAACACCTATTCTGA