Upeneus moluccensis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Upeneus moluccensis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Upeneus
  • Species » moluccensis
  • Upeneus moluccensis
    (Goldband goatfish)
  • Description »  

    Marine; brackish; reef-associated; depth range 10 - 120 m . Subtropical; 35°N - 27°S, 32°E - 168°E

    Maturity: Lm ?, range 14 - ? cm Max length : 22.5 cm TL male/unsexed; ; common length : 18.0 cm TL male/unsexed; ; max. reported age: 5 years

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7. This species is distinguished by the following characters: D VIII,9; pectoral fins 14-16; gill rakers 7-8 + 18-20 = 26-27; lateral line scales 33-35; body depth at first dorsal-fin origin 24-26% SL and at anus 21-23% SL; caudal-peduncle depth 9.0-10% SL; maximum head depth 20-22% SL; head depth through eye 16-17% SL; head length 27-29%SL; orbit length 7.3-8.9% SL; upper jaw length 11-12% SL; barbel length 15-17% SL; caudal-fin length 27-30% SL; anal-fin height 13-15% SL; pelvic-fin length 17-22% SL; pectoral-fin length 25-27% SL; first dorsal-fin height 20-23% SL; second dorsal-fin height 14-16% SL; 6-8 thin, red caudal fin bars on upper lobe (faintly retained when preserved), none on lower lobe but with a red broad band covering the entire lobe apart from the distal, inner margin, the latter somewhat darker (most of which are lost in preserved fish); one mid-lateral body stripe yellow or gold from eye to upper caudal-fin base (not or faintly retained in preserved fish); dark first dorsal-fin tip (retained in preserved fish); white barbels; silvery-rose body, dorsally darkened above lateral stripe (pale brown, slightly darkened dorsally in preserved fish) . Body shape (shape guide): fusiform / normal;  Cross section: circular.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1912_TORL_021A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524708
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:14 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTACCTAGTCTTCGGTGCTTGAGCTGGAATAGTAGGAACTGCTTTAAGCCTTCTTATTCGTGCTGAATTATCTCAACCTGGGGCCCTCCTAGGTGACGATCAAATTTACAACGTAATTGTTACGGCGCACGCCTTTGTAATAATTTTCTTCATGGTAATGCCAATTATGATCGGAGGATTTGGTAACTGACTTATCCCACTAATGATTGGTGCGCCAGACATGGCCTTCCCCCGAATGAATAACATGAGCTTCTGGCTCCTGCCTCCTTCTTTCCTGCTACTGCTTGCCTCTTCAGGCGTCGAAGCCGGAGCCGGAACAGGTTGAACTGTATACCCACCTCTAGCAGGCAACCTAGCACACGCCGGGGCCTCAGTTGACCTAACCATTTTCTCGCTTCACCTGGCAGGTATCTCTTCTATTCTAGGGGCTATTAATTTTATCACCACAATTATTAATATGAAACCCCCAGCAATTTCACAGTACCAGACACCTCTATTTGTATGAGCTGTACTAATTACAGCCGTTCTTCTCCTTCTGTCCCTGCCAGTTCTTGCTGCAGGTATTACAATGCTACTTACAGATCGAAACCTCAACACAACGTTCTTCGATCCAGCAGGCGGAGGAGACCCAATCCTTTACCAACACTTGTTCTGA