Upeneus moluccensis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Upeneus moluccensis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Upeneus
  • Species » moluccensis
  • Upeneus moluccensis
    (Goldband goatfish)
  • Description »   (Wikipedia) Upeneus moluccensis, the goldband goatfish, golden-banded goatfish or Moluccan goatfish, is a species of Indo-Pacific goatfish from the red mullet and goatfish family, the Mullidae. It is widespread in the warmer waters of the Indian and Pacific Oceans as far east as New Caledonia and has colonised the eastern Mediterranean Sea from the Red Sea via the Suez Canal, making it a Lessepsian migrant.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   MIN_1912_TORL_021A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524708
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:14 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTACCTAGTCTTCGGTGCTTGAGCTGGAATAGTAGGAACTGCTTTAAGCCTTCTTATTCGTGCTGAATTATCTCAACCTGGGGCCCTCCTAGGTGACGATCAAATTTACAACGTAATTGTTACGGCGCACGCCTTTGTAATAATTTTCTTCATGGTAATGCCAATTATGATCGGAGGATTTGGTAACTGACTTATCCCACTAATGATTGGTGCGCCAGACATGGCCTTCCCCCGAATGAATAACATGAGCTTCTGGCTCCTGCCTCCTTCTTTCCTGCTACTGCTTGCCTCTTCAGGCGTCGAAGCCGGAGCCGGAACAGGTTGAACTGTATACCCACCTCTAGCAGGCAACCTAGCACACGCCGGGGCCTCAGTTGACCTAACCATTTTCTCGCTTCACCTGGCAGGTATCTCTTCTATTCTAGGGGCTATTAATTTTATCACCACAATTATTAATATGAAACCCCCAGCAATTTCACAGTACCAGACACCTCTATTTGTATGAGCTGTACTAATTACAGCCGTTCTTCTCCTTCTGTCCCTGCCAGTTCTTGCTGCAGGTATTACAATGCTACTTACAGATCGAAACCTCAACACAACGTTCTTCGATCCAGCAGGCGGAGGAGACCCAATCCTTTACCAACACTTGTTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 989 visit(s) today - 303086 total visits (551 average daily visits): 2023-05-22 - 2024-11-22 (550 days)