Novaculichthys taeniourus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Novaculichthys taeniourus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Labridae
  • Genus » Novaculichthys
  • Species » taeniourus
  • Novaculichthys taeniourus
    (Rockmover wrasse)
  • Description »   (Wikipedia) Novaculichthys taeniourus, also known as the rockmover wrasse, carpet wrasse, dragon wrasse, bar-cheeked wrasse, olive-scribbled wrasse or reindeer wrasse, is a species of wrasse mainly found in coral reefs and lagoons in the Indo-Pacific region. These include habitats in the Gulf of California to Panama; tropical Pacific Ocean islands including Hawaii; the Philippines, Indonesia and Australia; and the Indian Ocean to the east coast of Africa. The common name, "rockmover wrasse", comes from their behavior of upending small stones and reef fragments in search of prey. This species is the only known member of its genus.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Maria, Davao Occidental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   MIN_1910_STAM_014A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524531
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 3:40 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TGCACCCTTTATCTAGTTTTCGGTGCTTGGGCAGGGATAGTGGGCACAGCTCTGAGCCTGCTTATCCGGGCCGAACTTAGTCAACCCGGCGCCCTTCTAGGCGACGATCAGATTTATAATGTAATCGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTCGGAAACTGACTTATTCCCCTAATAATCGGAGCTCCAGACATGGCCTTCCCTCGAATAAACAATATGAGCTTCTGACTCCTTCCACCTTCCTTCCTGCTCCTTCTAGCATCCTCTGGAGTAGAAGCAGGGGCAGGGACAGGTTGAACTGTTTATCCCCCCTTAGCTGGTAACCTGGCCCACGCCGGCGCATCTGTTGACCTCACAATTTTCTCCCTTCACTTGGCAGGAATCTCCTCAATTCTCGGCGCCATTAACTTTATCACAACTATTATTAACATAAAACCCCCAGCTATTTCTCAATACCAGACTCCTTTATTTGTTTGAGCCGTTCTAATTACAGCCGTTCTTCTTCTTCTCTCCCTCCCCGTCCTTGCTGCCGGCATTACAATGCTTCTTACAGACCGAAATTTAAATACAACATTCTTTGACCCAGCCGGGGGAGGAGACCCAATCCTGTACCAACACCTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 373 visit(s) today - 305304 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)