Ostorhinchus doederleini | University of the Philippines Mindanao | Marine Biodiversity Database Project
Ostorhinchus doederleini
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Kurtiformes
  • Family » Apogonidae
  • Genus » Ostorhinchus
  • Species » doederleini
  • Ostorhinchus doederleini
    (Doederlein's cardinalfish)
  • Description »  

    Marine; reef-associated; depth range 0 - 10 m . Subtropical

    Maturity: Lm ?  range ? - ? cm Max length : 14.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 2; Anal soft rays: 8. Distinguished by having the following characteristics: dorsal fin rays VII-I, 9; anal fin rays II, 8; pectoral fin rays 15; pelvic fin rays I, 5; pored lateral line scales 24; predorsal scales 3; circumpeduncular scales 12; body pinkish brown, with four dark brown stripes on lateral surface of body; third stripe posteriorly not reaching to a black spot on caudal fin base; caudal fin base spot subequal in size to pupil diameter . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1912_TORL_035A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:05 February 2021 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524535
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:13 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTAGTATTTGGTGCTTGGGCCGGAATAGTCGGAACTGCACTTAGCCTTCTCATTCGAGCTGAGCTGAGTCAACCCGGGGCCCTTCTCGGTGATGATCAGATTTATAATGTAATCGTCACAGCACACGCATTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGGAACTGACTAATTCCCCTAATGATTGGCGCCCCAGACATGGCATTCCCACGAATAAATAATATGAGCTTCTGACTTCTTCCTCCCTCTTTCCTTCTTCTACTTGCCTCCTCTGGCGTAGAGGCTGGAGCCGGGACAGGGTGAACCGTATACCCCCCTCTTGCAGGCAACCTTGCCCATGCAGGGGCTTCTGTTGATTTAACAATCTTTTCCCTACACCTAGCGGGTGTGTCATCAATTCTTGGGGCAATTAATTTTATCACTACAATTATTAATATGAAACCCCCTGCAATTACCCAATATCAGACTCCCCTGTTTGTCTGAGCAGTCCTCATTACTGCAGTACTTCTTCTCCTTTCTTTACCTGTCCTAGCAGCCGGCATTACAATGCTCCTTACAGATCGAAACCTAAATACAACCTTCTTTGATCCAGCAGGGGGTGGAGATCCGATTCTCTATCAACACCTCTTCTGA