Gerres filamentosus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Gerres filamentosus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Gerreidae
  • Genus » Gerres
  • Species » filamentosus
  • Gerres filamentosus
    (Whipfin silver-biddy)
  • Description »  

    Marine; freshwater; brackish; demersal; amphidromous ; depth range 1 - 50 m . Tropical; 26°C - 29°C ; 32°N - 35°S, 25°E - 171°E

    Maturity: Lm 19.0  range ? - ? cm Max length : 39.0 cm TL male/unsexed; ; common length : 15.0 cm SL male/unsexed; ; max. reported age: 8 years

    Dorsal spines (total): 9; Dorsal soft rays (total): 10 - 11; Anal spines: 2 - 3; Anal soft rays: 7 - 8. Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1912_TORL_042A]
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 July 2016 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524397
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:13 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTACCTGGTCTTCGGTGCTTGGGCTGGAATAGTAGGAACAGCCCTTAGCTTACTCATCCGAGCTGAGCTATGTCAACCTGGTTCTCTCCTAGGAGACGATCAGATCTATAATGTTATCGTCACAGCTCACGCATTTGTAATAATTTTTTTTATGGTTATGCCAATCATGATTGGAGGGTTCGGGAACTGACTGATCCCCCTAATGATTGGAGCGCCAGATATGGCATTCCCCCGAATAAATAACATAAGCTTTTGACTCCTGCCTCCTTCGTTCCTCCTTCTCTTAGCTTCATCGGGTGTAGAAGCAGGAGCCGGAACTGGATGAACTGTATATCCCCCTCTGTCCGGAAACCTAGCTCACGCGGGAGCATCCGTTGACCTAACCATCTTCTCGCTCCACCTAGCTGGAATTTCATCAATTCTGGGGGCCATTAACTTCATTACTACAATCATCAACATGAAACCTCCCGCTATTTCCCAATACCAAACACCTCTCTTCGTCTGATCTGTCCTAATTACCGCAATTCTTCTGCTCCTGTCACTTCCTGTTTTAGCTGCTGGAATCACGATGTTACTAACAGATCGAAACCTAAACACCACATTCTTTGACCCTGCAGGGGGTGGAGACCCAATTCTTTACCAACATCTCTCCTGA

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2025 - All Rights Reserved. 718 visit(s) today - 745433 total visits (978 average daily visits): 2023-05-22 - 2025-06-22 (762 days)