Chromis ternatensis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Chromis ternatensis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Pomacentridae
  • Genus » Chromis
  • Species » ternatensis
  • Chromis ternatensis
  • Description »   (Wikipedia) Chromis is a genus of fish in the family Pomacentridae. While the term damselfish describes a group of marine fish including more than one genus, Chromis is the largest genus of damselfishes. Certain species within the genus are common in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Maria, Davao Occidental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   MIN_1910_STAM_018A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524345
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 3:20 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTAGTATTTGGTGCCTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTACTAATTCGAGCGGAACTAAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTATAATGTCATCGTGACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGATTTGGCAACTGACTTATCCCTCTCATGATCGGAGCCCCCGACATGGCATTCCCACGAATGAACAATATGAGCTTCTGACTTCTACCCCCCTCATTCCTTCTTCTACTTGCCTCCTCTGGTGTTGAAGCAGGGGCAGGAACAGGGTGGACTGTCTACCCCCCATTGTCAGGAAACCTAGCCCACGCTGGAGCATCCGTTGACCTAACCATCTTCTCCTTACACTTGGCAGGTATTTCATCGATTCTAGGGGCAATCAACTTCATTACAACTATTATCAACATGAAACCCCCTGCAATTTCCCAATACCAGACCCCTCTTTTCGTATGAGCAGTTCTCATTACTGCCGTCCTTCTCCTTCTATCCCTTCCAGTTTTAGCTGCTGGCATCACTATGCTCCTAACCGATCGCAACCTAAACACTACATTCTTCGACCCCGCAGGAGGAGGAGATCCAATCCTTTATCAACATCTATTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1176 visit(s) today - 304662 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)