Rexea prometheoides | University of the Philippines Mindanao | Marine Biodiversity Database Project
Rexea prometheoides
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Gempylidae
  • Genus » Rexea
  • Species » prometheoides
  • Rexea prometheoides
  • Description »  

    Marine; benthopelagic; depth range 135 - 540 m . Tropical; 36°N - 31°S, 34°E - 157°E

    Maturity: Lm ?  range ? - ? cm Max length : 40.0 cm SL male/unsexed;

    Dorsal spines (total): 19 - 20; Dorsal soft rays (total): 14 - 17; Anal spines: 2; Anal soft rays: 12 - 15; Vertebrae: 34. Lateral line branching below the 4th to the 5th spine of the first dorsal fin; the upper branch reaching the middle to end of the second dorsal-fin base; the lower branch running mid laterally. Body naked except for a large scaly patch extending around the posterior portion of the lower lateral line. The pelvic fin is represented by a single spine in smaller specimens but is entirely absent in specimens over 18 - 20 cm SL. Body color is grayish with silvery tint; the fins hyaline except for the black blotch on the fin membranes between the first and the third first dorsal spines. Body shape (shape guide): elongated;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1912_TORL_046B]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Not Evaluated (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524614
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:13 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TGCACCTTATATCTCGTATTCGGTGCATGGGCCGGGATAGTGGGAACGGCCTTAAGCCTGCTTATTCGGGCTGAGCTCAGCCAGCCCGGATCCCTGCTTGGGGACGATCAGATCTATAACGTAATCGTTACGGCGCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCGATTATAATTGGCGGGTTTGGAAACTGACTTATCCCCCTAATAATTGGAGCCCCTGACATGGCATTCCCCCGAATAAATAACATAAGCTTTTGACTTCTGCCACCCTCCTTTCTCCTTCTACTGGCCTCCTCCGGAGTTGAAGCCGGGGCTGGGACAGGGTGAACAGTTTATCCTCCTCTGTCAGCTAACCTCGCCCATGCAGGAGCATCAGTTGACCTAACTATTTTTTCTTTACACTTAGCAGGAATCTCCTCAATCTTAGGGGCCATTAATTTCATCACAACAATCCTAAATATAAAACCTGTTGCTATTTCACAGTACCAAACCCCCTTATTTGTTTGGGCTGTCCTAATTACGGCTGTGCTTCTACTCCTTTCCCTCCCAGTTCTTGCTGCGGGGATTACTATGCTTCTAACAGACCGAAACCTTAACACAACCTTCTTTGACCCTGCAGGAGGGGGAGACCCAATTCTATATCAACATCTATCCTGA