Lethrinus ornatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lethrinus ornatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Lethrinidae
  • Genus » Lethrinus
  • Species » ornatus
  • Lethrinus ornatus
    (Ornate emperor)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 5 - 30 m . Tropical; 30°N - 27°S, 70°E - 154°E

    Maturity: Lm ?  range ? - 20 cm Max length : 45.0 cm TL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body relatively deep, its depth 2.3-2.6 times in standard length. Head length 0.8-0.9 times in body depth, 2.7-3 times in SL, dorsal profile near eye convex; snout length about 2-2.5 times in HL, measured without the lip the snout is 0.9-1.1 times in cheek height, its dorsal profile nearly straight or slightly concave, snout angle relative to upper jaw between 65° and 75°; interorbital space convex; posterior nostril a longitudinal oblong opening, closer to orbit than anterior nostril; eye situated close to dorsal profile, its length 3.3-4.1 times in HL; cheek height 2.2-2.8 times in HL; lateral teeth in jaws rounded with points or molars; outer surface of maxilla usually smooth, sometimes with a longitudinal ridge. D X,9 with the 4th or 5th dorsal-fin spine the longest, its length 2.7-3.3 times in body depth; A III,8 with the first soft ray usually the longest, its length longer than length of base of soft-rayed portion of anal fin and 1.1-1.5 times in length of entire anal-fin base; pectoral-fin rays 13; pelvic-fin membranes between rays closest to body without dense melanophores; cheek without scales; 46-47 lateral-line scales; 5 ½ scale rows between lateral line and base of middle dorsal-fin spines; 15-16 scale rows in transverse series between origin of anal fin and lateral line; 13-15 rows in lower series of scales around caudal peduncle; usually 3-8 scales in supratemporal patch; inner surface of pectoral-fin base densely covered with scales; posterior angle of operculum fully scaly. Colour of body dusky whitish, lighter below, with 5-6 orange stripes; posterior edge of opercle and preopercle bright red (the former more conspicuous); head brown or tan, sometimes a red spot on lower front edge of eye; pectoral fins orangish; pelvic and anal fins, and most of dorsal fin whitish; edge of dorsal and caudal fins reddish . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Maria, Davao Occidental] [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [MIN_1910_STAM_024A] [FDP_SGES_2112_023A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:09 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524453
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:11 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TGCACCCTTTATTTAGTGTTTGGTGCCTGAGCTGGAATGGTAGGAACAGCCCTAAGCCTACTCATTCGAGCCGAACTAAGTCAACCCGGAGCCCTCCTGGGAGACGACCAAATTTATAATGTTATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATGGTAATGCCTATTATGATTGGAGGTTTCGGCAACTGACTTATCCCCCTAATGATTGGCGCCCCCGACATGGCATTCCCTCGGATGAATAACATGAGCTTTTGACTTCTGCCCCCTTCATTCCTCCTCCTACTTGCCTCTTCGGGCGTAGAGGCTGGGGCTGGGACCGGATGAACAGTTTATCCCCCACTAGCAGGCAACCTTGCCCACGCTGGAGCATCTGTCGACTTAACAATTTTTTCCCTCCATCTGGCAGGGGTCTCCTCAATTTTAGGGGCCATCAACTTCATCACAACAATCATTAACATGAAGCCTCCGGCTATTTCTCAATATCAAACACCCCTGTTTGTGTGAGCCGTTCTAATCACCGCCGTACTACTTCTCCTGTCCCTGCCAGTCCTTGCCGCCGGCATCACAATGCTGTTGACAGACCGAAACCTAAACACCACCTTCTTTGACCCCGCAGGAGGAGGGGACCCAATCCTCTATCAGCACCTATTCTGA