Lethrinus obsoletus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lethrinus obsoletus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Lethrinidae
  • Genus » Lethrinus
  • Species » obsoletus
  • Lethrinus obsoletus
    (Orange-striped emperor)
  • Description »  

    Marine; reef-associated; non-migratory; depth range ? - 30 m . Tropical; 27°N - 26°S, 33°E - 138°W

    Maturity: Lm 23.7  range ? - 25.7 cm Max length : 60.0 cm TL male/unsexed; ; common length : 30.0 cm TL male/unsexed; ; max. reported age: 14 years

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 8. The body is light tan or olive to brown, becoming lighter below. the centers of the scales are often lighter than the background color. The head, often, has several broad indistinct vertical and diagonal light and dark bands. Sometimes there are white spots below the eye. The posterior edge of the operculum is dark brown. An orange-yellow stripe is on the lower part of the side with two additional more faint orange-yellow stripes above and one below this stripe. The fins are whitish or tan, sometimes mottled. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2202_046A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:09 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524448
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 27, 2024, 5:28 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TAGTGTTTGGTGCCTGAGCAGGATTGGTGGGAACAGCCTTAAGCCTTCTTATTCGAGCCGAACTTAGTCAGCCTGGAGCTCTCCTGGGAGACGACCAAATTTATAATGTTATTGTTACAGCACATGCTTTCGTAATGATTTTCTTTATGGTTATGCCTATTATGATTGGAGGTTTCGGCAACTGACTAATCCCCCTAATGATTGGAGCGCCTGACATAGCATTCCCCCGAATGAATAACATGAGCTTTTGACTTCTACCCCCTTCGTTCCTCCTCCTACTTGCCTCTTCAGGCGTGGAAGCTGGGGCTGGTACCGGGTGAACAGTTTACCCGCCCCTAGCAGGCAACCTCGCCCATGCTGGGGCATCTGTCGACTTGACAATCTTCTCCCTCCACCTAGCAGGGGTCTCCTCAATTCTTGGGGCTATTAACTTCATCACAACAATCATTAACATGAAGCCCCCAGCTATTTCTCAATACCAAACACCCCTCTTTGTATGAGCCGTTTTAATCACCGCCGTACTGCTTCTCCTGTCCCTACCAGTCCTTGCCGCCGGCATCACAATGCTACTGACAGACCGAAACCTAAACACCACCTTCTTTGACCCTGCAGGAGGAGGGGACCCCATCCTCTATCAACACCTGTTTTGATTCTTT