Balistoides viridescens | University of the Philippines Mindanao | Marine Biodiversity Database Project
Balistoides viridescens
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Tetraodontiformes
  • Family » Balistidae
  • Genus » Balistoides
  • Species » viridescens
  • Balistoides viridescens
    (Titan triggerfish)
  • Description »  

    Marine; reef-associated; depth range 0 - 60 m . Tropical; 35°N - 26°S, 32°E - 122°W

    Maturity: Lm ?  range ? - ? cm Max length : 75.0 cm TL male/unsexed;

    Dorsal spines (total): 3; Dorsal soft rays (total): 24 - 26; Anal spines: 0; Anal soft rays: 22 - 24. Fish has a deep grove before eye; scaleless area around lips, continuing and narrowing posterior to corner of mouth; small forward-curving spines in about five rows on side of and a short distance anterior to caudal peduncle. Caudal peduncle compressed .

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2202_040A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 January 2022 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524260
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 27, 2024, 5:26 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCTTATACCTGATTTTCGGTGCTTGAGCCGGAATGGTAGGAACCGCTTTAAGCCTACTAATCCGAGCAGAATTAAGCCAACCCGGCGCTCTTTTAGGAGACGATCAAATTTATAACGTTATCGTCACAGCACATGCTTTCGTGATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTCGGGAACTGACTCGTTCCTCTAATAATTGGAGCCCCCGACATAGCATTCCCTCGCATGAACAATATGAGCTTCTGACTCCTACCTCCATCGCTTCTTCTCTTACTTGCCTCATCAAGCGTAGAAGCAGGGGCCGGTACCGGATGAACAGTCTACCCTCCACTAGCAGGAAACCTAGCCCACGCAGGTGCTTCTGTAGACCTTACCATTTTCTCACTACACTTAGCAGGAATCTCCTCTATTCTTGGAGCAATCAATTTTATTACAACCATTATTAACATGAAACCCCCCGCCATTTCTCAATACCAGACGCCACTGTTCGTCTGAGCTGTCCTTATCACCGCAGTCCTACTGCTCTTGTCCCTCCCTGTTTTAGCTGCCGGAATTACCATACTACTTACCGACCGAAATCTAAACACCACCTTCTTTGACCCTGCTGGAGGAGGAGACCCAATTCTTTACCAACATTTATTCTGATTCTTC