Parupeneus heptacantha | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus heptacantha
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » heptacantha
  • Parupeneus heptacantha
    (Cinnabar goatfish)
  • Description »  

    Marine; brackish; reef-associated; depth range 12 - 350 m , usually ? - 60 m . Tropical; 35°N - 33°S

    Maturity: Lm ?  range ? - ? cm Max length : 36.0 cm TL male/unsexed; ; common length : 25.0 cm TL male/unsexed; ; max. published weight: 877.00 g ; max. reported age: 6 years

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7. Diagnosis: Pectoral rays 16 (rarely 15 or 17). Gill rakers 6-7 + 29-23 (total 26-30). Body depth 2.95-3.55 in SL; head length (HL) 2.9-3.25 in SL; snout length 1.75-2.1 in HL; barbel length 1.15-1.35 in HL; posterior end of maxilla evenly convex; longest dorsal spine 1.45-1.75 in HL; penultimate dorsal ray 1.05-1.25 in length of last dorsal ray; pectoral-fin length 1.25-1.4 in HL; pelvic-fin length 1.4-1.6 in HL. Body brownish yellow to light red (deeper-dwelling fish more red), the edges of the scales darker, shading to silvery white ventrally; adults with a small reddish brown spot on upper side of body just below seventh and eighth lateral-line scales; an indistinct narrow yellow stripe often visible above the lateral line (more evident in juveniles and subadults); dorsal body scales often with a pale blue or pearly spot; faint iridescent blue lines extending dorsoposteriorly and ventroanteriorly from eye, and often a parallel one on the cheek below eye; second dorsal and anal fins with faint pale blue or pink narrow bands alternating with pale yellow. Although Gloerfelt- Tarp and Kailola (1984: 213) reported that this species (as Parupeneus pleurospilus) has a dark brown peritoneum, the Bishop Museum specimens have a pale peritoneum . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2202_029A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524553
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 27, 2024, 5:21 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTACCTAGTCTTCGGTGCCTGAGCCGGAATAGTAGGAACTGCTTTAAGCCTACTTATTCGAGCCGAGCTCAGCCAGCCTGGCGCTCTCTTAGGTGACGACCAGATCTACAACGTAATCGTTACAGCCCACGCCTTTGTAATGATTTTCTTCATGGTTATGCCAATCATGATCGGAGGGTTCGGAAACTGACTCATCCCACTTATGATCGGCGCACCAGATATGGCCTTCCCCCGAATGAACAACATGAGCTTTTGACTCCTCCCACCTTCCTTCCTACTCCTACTCGCCTCGTCAGGCGTTGAAGCTGGGGCAGGGACTGGCTGAACAGTTTATCCCCCACTAGCAGGAAACCTGGCACATGCCGGGGCATCCGTAGACCTAACCATCTTCTCCCTCCACCTTGCAGGTATTTCCTCTATTCTAGGGGCTATTAATTTTATTACTACAATCATTAATATGAAACCCCCAGCAATTTCGCAGTACCAAACGCCTCTGTTCGTTTGAGCTGTCCTAATTACAGCTGTCCTTCTCCTTCTATCACTCCCAGTTCTTGCCGCTGGCATCACAATGCTACTGACAGACCGAAACCTAAATACAACCTTCTTCGACCCGGCAGGAGGGGGAGACCCAATCCTCTACCAACACCTATGCTGATTCTTC