Upeneus vittatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Upeneus vittatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Upeneus
  • Species » vittatus
  • Upeneus vittatus
    (Yellowstriped goatfish)
  • Description »  

    Marine; brackish; reef-associated; depth range 5 - 100 m . Tropical; 26°C - 29°C; 32°N - 33°S, 28°E - 137°W

    Maturity: Lm 12.8, range 10 - ? cm Max length : 28.0 cm TL male/unsexed; ; common length : 20.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7. This species is distinguished by the following characters: D VIII,9; pectoral fins 15-16; gill rakers 7-8 + 19-21 = 27-29; lateral line scales 36-38; body depth at first dorsal fin origin 25-29% SL and at anal-fin origin 21-24% SL; caudal-peduncle depth 9.9-12% SL; maximum head depth 21-26% SL; head depth through eye 18-20% SL; head length 30-31%SL; orbit length 7.0-8.7% SL; upper jaw length 11-13% SL; barbel length 17-21% SL; caudal-fin length 26-30% SL; anal-fin height 15-16% SL; pelvic-fin length 18-21% SL; pectoral-fin length 22-24% SL; first dorsal-fin height 22-25% SL; second dorsal-fin height 14-16% SL; 7-9 total bars on caudal fin, 4-5 brown or dark brown bars on upper caudal-fin lobe, 3 (rarely 4) bars on lower lobe, increasing distally in width with the widest distal-most bar black or dark brown, while the other bars are pale brown or brown; width of largest lower caudal-fin lobe bar and/or pale interspace between distal-most bars equal to or larger than orbit; tip of lower fin lobe pale (bars on both caudal-fin lobes retained on preserved fish); tip of first dorsal-fin dark, the vertical length of the pigmented area similar in size to width of widest lower caudal-fin lobe bar; 2 yellow or pale brown mid-lateral body stripes, one from eye to caudal-fin base, where it joins the proximal upper caudal-fin lobe bar, and the other stripe below from pectoral-fin base to caudal peduncle and continued by proximal-most lower caudal fin lobe bar; 2 dorsolateral brown or pale brown stripes, with the lower one distinct and well-separated from pale body surface, extending from operculum to behind second dorsal fin, the upper one indistinct or hidden and much shorter, beginning below first dorsal-fin origin and bordered dorsally by a horizontal series of pale spots (lateral body stripes not retained on preserved fish); barbels white; white to silvery body. Dark reddish-brown dorsally, white belly, faint yellowish patches along pelvic and anal-fin bases (body pale brown in preserved fish, slightly darker above lateral line) . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2202_027A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524715
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 27, 2024, 5:21 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTACCTGGTCTTCGGTGCTTGAGCCGGAATAGTAGGAACTGCTTTAAGCCTTCTTATTCGTGCTGAACTATCTCAACCTGGGGCCCTCCTAGGTGATGATCAAATTTATAACGTAATTGTTACGGCGCATGCCTTTGTAATAATTTTCTTCATGGTAATGCCAATCATGATCGGGGGTTTCGGTAACTGACTCATCCCACTAATGATTGGTGCACCAGACATGGCCTTCCCTCGAATGAATAACATGAGCTTCTGGCTCCTACCCCCTTCTTTCCTTCTGCTGCTCGCCTCTTCGGGTGTTGAAGCCGGAGCAGGGACAGGTTGAACTGTCTATCCCCCTCTAGCGGGCAACCTAGCACACGCCGGGGCCTCGGTTGATCTTACCATCTTCTCCCTCCATCTAGCAGGTATTTCTTCCATTCTAGGGGCTATTAACTTCATTACCACAATTATTAATATGAAACCTCCAGCAATCTCACAATATCAAACACCTCTATTTGTGTGAGCCGTACTTATTACAGCCGTCCTTCTCCTTCTATCCCTGCCAGTCCTAGCTGCAGGCATTACAATGCTGTTAACAGATCGAAACCTCAATACAACCTTCTTCGATCCAGCAGGTGGAGGAGATCCAATTCTTTACCAGCATCTCTGCTGATTCTTC