Scolopsis affinis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scolopsis affinis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Nemipteridae
  • Genus » Scolopsis
  • Species » affinis
  • Scolopsis affinis
    (Peters' monocle bream)
  • Description »  

    Marine; reef-associated; depth range 3 - 60 m . Tropical; 32°N - 21°S, 96°E - 166°E

    Maturity: Lm ?  range ? - ? cm Max length : 24.0 cm TL male/unsexed; ; common length : 15.0 cm SL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 7. Lower limb of preopercle scaly. Antrorse (forward-directed) suborbital spine absent. Pelvic fins long, reaching to or beyond level of anus. Larger specimens with upper and lower lobes falcate. Presence of indistinct bluish stripe between eyes and a narrow white stripe from middle of upper lip to below eye. Juveniles with dusky brown stripe on either side of dorsal midline, and dusky brown midlateral stripe, yellowish above anteriorly. Axillary scale present. Color: Body silvery-white. Top of head and snout dusky grey. An indistinct bluish stripe between eyes. A narrow white stripe from middle of upper lip to below eye. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental] [General Santos City, South Cotabato] [Samal Island, Davao del Norte]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2202_021A] [FDP_SGES_2112_027B] [FDP_IGCS_2202_023A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:03 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524651
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:15 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATCTCTTATTTGGTGCCTGAGCCGGCATGGTTGGGACAGCATTAAGCCTCCTCATTCGAGCTGAATTAAGCCAGCCAGGCGCTCTTTTAGGGGACGACCAAATCTATAATGTGATCGTCACGGCCCATGCGTTTGTAATAATCTTCTTTATGGTCATGCCAATTATGATTGGAGGGTTCGGAAACTGGCTTATCCCACTAATAATTGGTGCACCCGACATAGCATTCCCTCGTATGAATAATATGAGTTTCTGACTACTTCCTCCATCGTTCCTTTTACTCTTGGCCTCCTCAGGGGTTGAAGCAGGCGCCGGAACAGGCTGAACAGTTTACCCCCCTCTTGCTGGTAATCTAGCTCATGCTGGGGCATCCGTAGATTTAACCATTTTTTCCCTTCACTTAGCAGGGGTCTCTTCAATTCTAGGGGCCATTAACTTTATTACAACAATCATCAACATAAAACCCCCAGCTATTACACAATATCAGACGCCTCTCTTTGTATGAGCCGTCCTAATTACAGCCGTCCTTCTTCTCCTTTCCCTCCCAGTGCTCGCTGCGGGTATCACAATGCTCCTCACAGATCGAAACCTTAATACAACATTCTTTGACCCTGCAGGAGGGGGAGACCCAATTCTTTACCAACACCTCTTCTGATTCTTC