Diagramma pictum | University of the Philippines Mindanao | Marine Biodiversity Database Project
Diagramma pictum
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Haemulidaec
  • Genus » Diagramma
  • Species » pictum
  • Diagramma pictum
    (Painted sweetlips)
  • Description »   (Wikipedia) The painted sweetlips (Diagramma pictum), also known as the Australian slatey, blackall, bluey, grey sweetlips, moke, morwong, mother-in-law fish, painted blubber-lips, slate bream, slate sweetlips, smokey bream, thicklip or yellowdot sweetlips is a species of marine ray-finned fish, a sweetlips belonging to the family Haemulidae. It is widespread throughout the tropical waters of the Indo-West Pacific region.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2202_016A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524363
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 10:56 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTAGTATTCGGTGCTTGAGCTGGAATAGTGGGAACGGCCCTAAGCCTGCTCATCCGGGCAGAGTTAAGCCAACCCGGCGCGCTCCTAGGAGACGACCAGATTTACAATGTTATCGTTACGGCGCATGCGTTCGTAATAATCTTCTTTATAGTTATACCTATCCTAATTGGAGGGTTCGGAAACTGACTAGTCCCGCTAATAATCGGAGCACCTGACATGGCATTCCCCCGAATGAACAATATGAGTTTCTGACTTCTCCCTCCGTCCTTCCTTCTCCTCCTTGCCTCCTCAGGCGTAGAAGCCGGGGCAGGGACTGGTTGAACAGTCTACCCCCCGTTGGCCGGAAATTTAGCGCACGCAGGTGCATCTGTAGACCTCACGATCTTCTCCCTACATCTGGCCGGTATCTCATCAATTCTCGGGGCGATTAATTTTATTACAACAATCATTAACATGAAACCCCCTGCAATTTCACAATATCAGACCCCTCTGTTTGTCTGATCAGTACTAGTAACCGCTGTTCTCCTACTCCTTTCCCTTCCGGTCCTTGCTGCTGGGATTACTATGCTCCTCACAGATCGAAACCTCAACACCACTTTCTTTGATCCTGCGGGGGGAGGAGACCCAATTCTTTACCAACACCTGTTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1329 visit(s) today - 304815 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)