Chaetodon unimaculatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Chaetodon unimaculatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Chaetodontidae
  • Genus » Chaetodon
  • Species » unimaculatus
  • Chaetodon unimaculatus
    (Teardrop butterflyfish)
  • Description »  

    Marine; reef-associated; depth range 1 - 60 m . Tropical; 35°N - 35°S, 95°E - 125°W

    Maturity: Lm ?  range ? - ? cm Max length : 20.0 cm TL male/unsexed; ; common length : 16.0 cm TL male/unsexed;

    Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 19 - 23; Anal spines: 3; Anal soft rays: 18 - 20. Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_GOVG_2202_004A]
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:09 October 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524323
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 27, 2024, 5:13 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACCGCCTTAAGCCTGCTTATCCGAGCAGAACTCAGTCAACCAGGCACCCTTCTAGGCGACGACCAGATTTATAATGTTATCGTTACGGCCCATGCGTTCGTGATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGGCTAATCCCCCTAATGATCGGGGCCCCCGATATGGCCTTCCCTCGAATAAACAATATGAGCTTTTGACTCTTACCCCCCTCCTTCTTTCTTCTGCTTGCCTCCTCTGGCGTGGAGTCTGGGGCTGGAACAGGGTGAACGGTTTACCCCCCACTAGCTGGTAATCTGGCTCACGCCGGAGCATCAGTTGATTTGACCATCTTCTCCCTCCACCTCGCAGGGATCTCCTCTATTCTTGGGGCTATTAACTTCATCACAACAATTCTTAATATAAAACCACCTGCTATATCTCAGTATCAGACCCCCCTATTTGTATGGTCTGTCCTAATTACAGCCGTCCTGCTCCTCCTGTCCCTGCCTGTCCTTGCAGCCGGTATTACAATACTTCTAACAGACCGAAACCTGAATACAACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAGCATCTGTTCTGATTCTTC

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2025 - All Rights Reserved. 2291 visit(s) today - 597578 total visits (856 average daily visits): 2023-05-22 - 2025-04-19 (698 days)