Coradion chrysozonus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Coradion chrysozonus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygiic
  • Order » Perciformes
  • Family » Chaetodontidae
  • Genus » Coradion
  • Species » chrysozonus
  • Coradion chrysozonus
    (Goldengirdled coralfish)
  • Description »   (Wikipedia) Coradion chrysozonus, the orangebanded coralfish or goldengirdled coralfish, is a species of marine ray-finned fish, a butterflyfish from the family Chaetodontidae. It is found in the Indo-Pacific with a distribution consisting of colonies scattered along the coast of Queensland, the Frankland Group off north Queensland west to Western Australia, New Guinea; Indonesia and the Philippines. It is rare along the Chinese coast and had recently been recorded from Tonga. It is normally encountered as solitary individuals or in pairs which inhabit a range of coastal to outer reefs habitats and which have rich growths of invertebrates. This species may prefer reefs in deeper cooler water. It is an omnivorous species which feeds mainly on sponges but also on small invertebrates which it grazes off the surface of the sponges.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental] [Mati City, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_GOVG_2202_003A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524349
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 10:36 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATCTAGTATTCGGTGCCTGAGCAGGTATAGTAGGAACAGCCCTGAGCCTACTCATCCGAGCAGAACTAAGTCAACCTGGTGCTCTCCTAGGGGATGACCAGATTTATAATGTTATCGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTCGGAAACTGACTTATTCCGCTAATGATCGGAGCCCCTGATATAGCCTTTCCCCGAATAAATAATATAAGTTTCTGACTTCTCCCTCCGTCTTTCTTCCTTCTACTTGCCTCTTCCGGTGTAGAAGCTGGGGCTGGCACTGGCTGAACTGTTTATCCCCCATTAGCAGGAAACCTTGCACACGCAGGAGCATCCGTCGACTTAACCATCTTTTCTCTACATCTGGCAGGAATTTCCTCTATCTTAGGTGCTATTAACTTTATTACTACTATTATCAACATGAAACCTCCCGCCATAACACAATACCAGACCCCCTTATTTGTTTGATCTGTTCTTATTACTGCCGTCTTACTTCTTCTGTCCCTCCCTGTTCTCGCAGCCGGAATTACAATGCTACTAACAGACCGTAATCTTAATACAACCTTCTTTGACCCCGCGGGAGGAGGAGACCCTATTCTGTACCAACACCTATCCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1264 visit(s) today - 304750 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)