Thalassoma jansenii | University of the Philippines Mindanao | Marine Biodiversity Database Project
Thalassoma jansenii
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Thalassoma
  • Species » jansenii
  • Thalassoma jansenii
    (Jansen's wrasse)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 1 - 15 m , usually 1 - 12 m . Tropical; 24°C - 28°C ; 35°N - 47°S, 70°E - 175°W

    Maturity: Lm ?  range ? - ? cm Max length : 20.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 13; Anal spines: 3; Anal soft rays: 11. Color pattern remains similar throughout life. Large juveniles and females are mostly black with a single white band and white area below the head to the anus. Males retain the white central band but is more yellow, and develops a second narrow band halfway towards the head . Initial phase white with 3 black bars, the first on upper half of head and anterior body containing a yellow streak at edge of opercle, the second across dorsal fin and ventrally to anus, the third covering most of body and posterior portions of dorsal and anal fins. Terminal male with yellow between black bars. Pectoral fins bluish . Body shape (shape guide): fusiform / normal.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Panabo Public Market]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [DNSC_ND_012A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:05 March 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524698
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 13, 2024, 7:49 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTCTATCTTGTGTTCGGCGCATGAGCCGGGATAGTGGGTACAGCCCTGAGCCTGCTCATTCGAGCTGAGCTAAGCCAGCCCGGCGCCCTCCTTGGAGACGATCAGATCTATAACGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAACATAAGCTTCTGACTTCTTCCCCCATCATTCCTCCTACTTCTTGCCTCTTCCGGTGTTGAAGCGGGGGCCGGAACCGGGTGAACTGTTTACCCGCCCTTGGCAGGTAACCTCGCCCACGCTGGTGCATCCGTCGACCTTACTATTTTTTCCCTACACCTGGCGGGCATCTCATCAATCCTAGGTGCAATTAACTTCATTACGACCATCATCAATATGAAACCCCCAGCCATCTCCCAGTATCAGACGCCTCTTTTCGTATGAGCCGTCCTGATTACAGCAGTCCTCCTTCTCCTCTCTCTCCCTGTTCTAGCTGCTGGTATTACAATGCTCCTAACGGACCGAAATCTAAACACCACCTTCTTTGACCCTGCCGGAGGGGGGGACCCAATTCTTTACCAACACCTATTCTGA